Oxidative Medicine and Cellular Longevity / 2020 / Article / Tab 1

Research Article

Chloroquine Improves Deoxynivalenol-Induced Inflammatory Response and Intestinal Mucosal Damage in Piglets

Table 1

Primers used for real-time quantitative PCR.

GenesAccession no.PrimersSequences (5-3)

β-ActinXM_003124280.3ForwardGGATGCAGAAGGAGATCACG
ReverseATCTGCTGGAAGGTGGACAG

GAPDHNM_001206359.1ForwardATCCTGGGCTACACTGAGGAC
ReverseAAGTGGTCGTTGAGGGCAATG

E-cadherinNM_001163060.1ForwardGAAGGAGGTGGAGAAGAGGAC
ReverseAGAGTCATAAGGTGGGGCAGT

OccludinNM_001163647.2ForwardAGAGTCATAAGGTGGGGCAGT
ReverseCGCCCGTCGTGTAGTCTGTC

ZO-1XM_005659811.1ForwardTACCCTGCGGCTGGAAGA
ReverseGGACGGGACCTGCTCATAACT

IntegrinNM_213968.1ForwardGCAGTTTCAAGGTCAAGATGG
ReverseAGCAGGAGGAAGATGAGCAG

TNFαNM_214022.1ForwardACAGGCCAGCTCCCTCTTAT
ReverseCCTCGCCCTCCTGAATAAAT

IL-6NM_214399.1ForwardTCCAGCATCATTGCATCATC
ReverseGGCTCCACTCACTCCACAAG

IL-8NM_213948.1ForwardTGAGAAGCAACAACAACAGCA
ReverseCAGCACAGGAATGAGGCATA

IFN-γNM_213948.1ForwardTTCAGCTTTGCGTGACTTTG
ReverseGGTCCACCATTAGGTACATCTG

TGF-β1NM_001173023.1ForwardAAGCGGCAACCAAATCTATG
ReverseCCCGAGAGAGCAATACAGGT

IL-1αNM_214029.1ForwardACCCGACTGTTTGTGAGTGC
ReverseTTCCCAGAAGAAGAGGAGACTG

IL-12NM_213993.1ForwardATCTCGGTTGGTGTTGTTCC
ReverseGGGTATCTCGTCCTCTGTCC

IL-4NM_214123.1ForwardCCCGAGTGTCAAGTGGCTTA
ReverseTGATGATGCCGAAATAGCAG

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.