Parkinson’s Disease / 2019 / Article / Tab 1

Research Article

Variants in the 3′ End of SLC6A3 in Northwest Han Population with Parkinson’s

Table 1

Primer of single-nucleotide polymorphisms of SLC6A3.

GeneUpstream primerDownstream primerPCR length

rs2270913GGTTCCCCTACCTGTGCTACAACAGCTTCATCTCGTTTCCG129
rs27048AAAGGCGGAGGAGGTGTTCCCAAACTGCGTTGACTTTTGG135
rs2270914GGTTCCCCTACCTGTGCTACAACAGCTTCATCTCGTTTCCG129
rs2550936CTCCCAAATAATCACGGGGCGCAGTTGGGTTCCTTCCACC124
rs11133767GAGAGGGTGAGCTCCTGAAGTGCTTTTTGTCACCTGCAGC139
rs3776510ACAGAGGAAGGGAGAAAGTGCGAGAGGGGCGTGGATTTCTC139
rs429699CCTCACGGAGCCTTTTTCAGTTTGGAGTGCTCATCGAAGC126
rs11564759AGCGCCCTTGGGAGTTCATGCACCCAGGGCAGATCTTCC131
rs27047ACAAATCACACACGTCCACACCCACGTCTAACCTCACGGG139
rs6347GGGTTCTGTTTCAGGGCCAGGATACCCAGGGTGAGCAGC118
rs40184TCTGATCAATACGCCCCAGAGCCAACACACCCTTGACAGG140
rs37022TGCTTGCTTTGACCTTTATGGCCAGCGCCCACTCTCAGTG140
rs10036478TCCCAGTTAGGAGCAGGGAGGAGCTAAAAGGCCATCCAGC134
rs2652514CCAGAACCCAGCCACAGAGATAGAGGCCAATGAGGGAGG138
rs2981359CAGAGTTTAGGAAAGGGAGGCCGCAGGCTGTTCTTTGGACC140
rs365663GTGAGACGCTGGCCATGTCTTGCCAACCCTGAGGAACAC138
rs11133770ACACCTCTGACCACAGTGTGAAGCCTGGGTTGTGGTCATC125

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.