Table 5

Gene locusForward primerReverse primerSize of PCR product

CRF WTGCTCAGCAAGCTCACAGCAAGAGCTTACACATTTCGTCC400 bp
CRF KOATCGCCTTCTTGACGACTTCGAGCTTACACATTTCGTCC600 bp
UCN1 WTGAGGGGACGCGCTACGCTCCGTCCGAGCTAGCTCCAGCAG400 bp
UCN1 KOGTCCGAGCTAGCTCCAGCAGGCGAATGGGCTGACCGCTTC900 bp