Stem Cells International / 2016 / Article / Tab 1

Research Article

Differentiation of Human Adipose Derived Stem Cells into Smooth Muscle Cells Is Modulated by CaMKIIγ

Table 1

qRT-PCR primer sequences.

NameSequence ()

a-SMA ForwardGGTGATGGTGGGAATGGG
ReverseGCAGGGTGGGATGCTCTT

Calponin ForwardATGTCCTCTGCTCACTTCA
ReverseTTTCCGCTCCTGCTTCTCT

SM22aForwardAACAGCCTGTACCCTGATGG
ReverseCGGTAGTGCCCATCATTCTT

SM-MHCForwardTGCTTTCGCTCGTCTTCC
ReverseCGGCAACTCGTGTCCAAC

Smoothelin 2ForwardCCCCTGAGATTGCCCAAAACT
ReverseCATGGGTGATAGAGCCGCAG

ACLPForwardACCCACACTGGACTACAATGA
ReverseGTTGGGGATCACGTAACCATC

CaMKIIαForwardACCACTACCTGATCTTCGACC
ReverseCCGCCTCACTGTAATACTCCC

CaMKIIβForwardGCACACCAGGCTACCTGTC
ReverseGGACGGGAAGTCATAGGCA

CaMKIIγForwardGTCTGTCAACGATCCACGGT
ReverseTCTGCCTGCCAACTGAGAAG

CaMKIIδForwardAGGGCTTTCACTACTTGGTGT
ReverseAGCCAAAGTCTGCCAATTTCA

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.