Stem Cells International / 2016 / Article / Tab 1

Research Article

Enhanced Proliferation of Porcine Bone Marrow Mesenchymal Stem Cells Induced by Extracellular Calcium is Associated with the Activation of the Calcium-Sensing Receptor and ERK Signaling Pathway

Table 1

The primer sequences used for real-time quantitative PCR.

GeneForward (5′-3′)Reverse (5′-3′)Amplification length (bp)

β-actinTGTCATGGACTCTGGGGATGGTGGTGGTGAAGCTGTAGCC156
CaSRGTGCCATAGAGGAAATAAACAGCCACGGCGATGGTAGAG198
Cyclin A2CCTTGGAAAGCAAACAGTAAACTTGGTCCAGGTAAAGTAACAGC148
Cyclin D3GGTCCTGGGGAAGCTCAAGTCATGGCAAAGGTGTAATCTGTA163
Cyclin E2AAACACCCCACAAAGAAATAGG CCCAGCTTAAATCAGGCAAA 105
PNCAGATGCTGTTGTAATTTCCTGTGCTCTATGGTAACTGCTTCCTCC 129
p21AGGACCATGTGGACCTGTTGTTAGGGCTTCCTCTTGGAGA173

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.