Stem Cells International / 2017 / Article / Tab 1

Research Article

Evaluating Wharton’s Jelly-Derived Mesenchymal Stem Cell’s Survival, Migration, and Expression of Wound Repair Markers under Conditions of Ischemia-Like Stress

Table 1

(a) Primer sequences used for semiquantitative RT-PCR analysis

S. numberGene nameForward primerReverse primer Size (bp)

1IGF-15′ TCTTGAAGGTGAAGATGCACACCA 3′5′ AGCGAGCTGACTTGGCAGGCTTGA 3′303
2COL14A15′ AAGCCCAGAGTCAAAGTTGTGGA 3′5′ CCATGAACCATCGACCAGGA 3′123
3MMP 25′ GGCCCTGTCACTCCTGAGAT 3′5′ GGCATCCAGGTTATCGGGGA 3′473
4ITGA15′ GGTTCCTACTTTGGCAGTATT 3′5′ AACCTTGTCTGATTGAGAGCA 3′149
5ITGA65′ TCCCTGAACCTAACGGAGTCT 3′ 5′ ATGTCCAAGTAGTTCAGTTTG 3′253
6SDF-15′ ATGAACGCCAAGGTCGTGGTC 3′5′ CTTGTTTAAAGCTTTCTCCAGGTACT 3′267
7WISP-15′ AGAGCCGCCTCTGCAACTT 3′5′ GGAGAAGCCAAGCCCATCA 3′245
8GAPDH5′ GAGTCAACGGATTTGGTCGT 3′5′ TTGATTTTGGAGGGATCTCG 3′248
9VTN5′ CGAGGAGAAAAACAATGCCAC 3′5′ GAAGCCGTCAGAGATATTTCG 3′498
10TSG 65′ CCCATTGTGAAGCCAGGGCCCAACTG 3′5′ GGAAGCTCATCTCCACAGTATCTTCCC 3′361
11HGF5′ TCACGAGCATGACATGACTCC 3′5′ AGCTTACTTGCATCTGGTTCC 3′302

(b) Human wound healing-related genes screened using the RT2 Profiler PCR Array

ACTA2ACTC1ANGPT1CCL2CCL7CD40LGCDH1COL14A1COL1A1COL1A2COL3A1COL4A1
COL4A3COL5A1COL5A2COL5A3CSF2CSF3CTGFCTNNB1CTSGCTSKCTSVCXCL1
CXCL11CXCL2CXCL5FGFEGFRF13A1F3FGAFGF10FGF2FGF7HBEGF
HGFIFN-GIGF1IL10IL1BIL2IL4IL6IL6STITGA1ITGA2ITGA3
ITGA-4ITGA-5ITGA-6ITGAVITGB1ITGB3ITGB5ITGB6MAPK1MAPK3MIFMMP1
MMP2MMP7MMP9PDGFAPLATPLAUPLAURPLGPTENPTGS2RAC1RHOA
SERPINE1STAT3TAGLNTGFATGFB1TGFBR3TIMP1TNFVEGFAVTNWISP1WNT5A

keeping genes. genomic DNA contamination control.
transcription control. PCR control.

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.