Stem Cells International / 2018 / Article / Tab 1

Research Article

N-Cadherin Upregulation Promotes the Neurogenic Differentiation of Menstrual Blood-Derived Endometrial Stem Cells

Table 1

Primer sequences.

GeneOligonucleotide sequence (5-3)Size (bp)Reference

NT3SenseTACGCGGAGCATAAGAGTCAC333[17]
AntisenseGGCACACACACAGGACGTGTC
NT4SenseCTTTCGGGAGTCAGCAGGTGC399[17]
AntisenseCAGGCAGTGTCAATTCGAATCC
BDNFSenseTTCCACCAGGTGAGAAGAGT474[18]
AntisenseACTAATACTGTCACACACGC
CNTFSenseTGGCTAGCAAGGAAGATTCGT519[19]
AntisenseAATATAATGGCTCCCACGTGC
NGFSenseCACACTGAGGTGCATAGCGT389[18]
AntisenseTGATGACCGCTTGCTCCTGT
LIFSenseATGTCACAACAACCTCATGAA466[19]
AntisenseGATCTGCTTATACTTCCCCAG
AntisenseAATGGTGATCCGGTTCTCCTC
CNPaseSenseAAGGACTTCCTGCCGCTCTA466[20]
AntisenseTGTCCACATCACTCGGCCAC
S100SenseATGTCTGAGCTGGAGAAGG338[21]
AntisenseCTGTCTGCTTTCTTGCATG
GFAPSenseGTGGTACCGCTCCAAGTTTGCAG376[17]
AntisenseAATGGTGATCCGGTTCTCCTC
N-cadSenseTGTTTGACTATGAAGGCAGTGG151[22]
AntisenseTCAGTCATCACCTCCACCAT
GAPDHSenseGAAGGTGAAGGTCGGAGT226[23]
AntisenseGAAGATGGTGATGGGATTTC