Stem Cells International / 2018 / Article / Tab 1

Research Article

The Effect of Age on the Regenerative Potential of Human Eyelid Adipose-Derived Stem Cells

Table 1

Primers for reverse transcription-polymerase chain reaction.

GenePrimer 5-3Amplicon length (bp)

AggrecanF: GACTTCCGCTGGTCAGATGG20
R: GTTTGTAGGTGGTGGCTGTG20

Runx-2F: TCGGAGAGGTACCAGATGGG20
R: CATTCCGGAGCTCAGCAGAA20

PPARγF: GCAGGAGCAGAGCAAAGAG19
R: GAGGAGAGTTACTTGGTCGTTC22

OPNF: TGGGAGGGCTTGGTTGTC18
R: TTCCTTGGTCGGCGTTTG18

SOX9F: AAAGGCTACGACTGGACG18
R: CGGCTGGTACTTGTAATCC19

COMPF: CGAGTCCGCTGTATCAACACC21
R: TCCGTGCAAACCTGCTTGT19

COL2F: GCTCCCAGAACATCACCTACC21
R: TGAACCTGCTATTGCCCTCT20