Stem Cells International / 2019 / Article / Tab 1

Research Article

The Role of CDR1as in Proliferation and Differentiation of Human Umbilical Cord-Derived Mesenchymal Stem Cells

Table 1

Primers used in this study.

NameSequences (5-3)Fragment size (bp)

Oct4-ForwardTTGAGGCTCTGCAGCTTAG285
Oct4-ReverseGCCGGTTACAGAACCACAC
Sox2-ForwardACACCAATCCCATCCACACT224
Sox2-ReverseGCAAACTTCCTGCAAAGCTC
Sall4-ForwardTCGATGGCCAACTTCCTTC142
Sall4-ReverseGAGCGGACTCACACTGGAGA
Lin28-ForwardTCGGCTTCCTGTCTATGACC155
Lin28-ReverseGGAATCCATCCGTGTCACTG
Nanog-ForwardCCTGATTCTTCCACCAGTCC292
Nanog-ReverseTGCTATTCTTCGGCCAGTTG
Adiponectin-ForwardGGCTATGCTCTTCACCTATG130
Adiponectin-ReverseTCCATTACGCTCTCCTTCC
ALP-ForwardATGGGATGGGTGTCTCCACA108
ALP-ReverseCCCACGAAGGGGAACTTGTC
OCN-ForwardCACTCCTCGCCCTATTGGC112
OCN-ReverseCCCTCCTGCTTGGACACAAAG
β-actin-ForwardGACCTGTACGCCAACACAGT129
β-actin-ReverseCTCAGGAGGAGCAATGATCT
CDR1as-ForwardACGTCTCCAGTGTGCTGA83
CDR1as-ReverseCTTGACACAGGTGCCATC
circBIRC6-ForwardTCAAGGAGACCAACTTTGGC268
circBIRC6-ReverseCTGGAGTTTGCAGAGCAGTG
circSMARCA5-ForwardTGGGCGAAAGTTCACTTAGAA236
circSMARCA5-ReverseTCTTTGCACCTCTTTCCAAAA
circASXL1-ForwardCTCGCATGCCTCAATGCTAT159
circASXL1-ReverseTGCCTCTATGACCTGCAGAA
circHIPK3-ForwardTCGGCCAGTCATGTATCAAA155
circHIPK3-ReverseTGCTTGGCTCTACTTTGAGTTTC