Stem Cells International / 2019 / Article / Tab 1

Research Article

Mesenchymal Stem Cells Alleviate Moderate-to-Severe Psoriasis by Reducing the Production of Type I Interferon (IFN-I) by Plasmacytoid Dendritic Cells (pDCs)

Table 1

Primers for mouse genes.

Gene namePrimers

GAPDHForward: ATGGTGAAGGTCGGTGTGA
Reverse: AATCTCCACTTTGCCACTGC

IFN-αForward: CCTGTGTGATGCAGG
Reverse: TCACCTCCCAGGCACAGA

TNF-αForward: CTGTAGCCCACGTCGTAGC
Reverse: TTAAGATCCATGCCGTTG

IL-17Forward: CTTCAACCAGCAGTCCCTAGACA
Reverse: TCCAGGTCCAGGAGACGGTA

IL-23Forward: AACTCCTCCAGCCAGAGGATCA
Reverse: TCTTGGAACGGAGAAGGGGG

S100A7Forward: GCCTCGCTTCATGGACAC
Reverse: CGGAACAGCTCTGTGATGTAGT

S100A8Forward: TCCTTGCGATGGTGATAAA
Reverse: GGCCAGAAGCTCTGCTACTC

S100A9Forward: GACACCCTGACACCCTGAG
Reverse: TGAGGGCTTCATTTCTCTTCTC

IL-10Forward: TGGGTTGCCAAGCCTTATCG
Reverse: TTCAGCTTCTCACCCAGGGA

IL-6Forward: CTGCAAGAGACTTCCATCCAGTT
Reverse: GAAGTAGGGAAGGCCGTGG