Table 2: Quantitative reverse transcription-PCR primer set list.

PrimerDirectionSequence (5-3)

β-ActinForwardCATCCGTAAAGACCTCTATGCCAAC
ReverseATGGAGCCACCGATCCACA

Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)ForwardGGTGTGAACCACGAGAAA
ReverseTGAAGTCGCAGGAGACAA

Sox2/sex determining region Y (SRY)-box 2ForwardGTTCTAGTGGTACGTTAGGCGCTTC
ReverseTCGCCCGGAGTCTAGCTCTAAATA

Fucosyltransferase 4 (FUT4·SSEA1)ForwardGCAGGGCCCAAGATTAACTGAC
ReverseAAGCGCCTGGGCCTAAGAA

Octamer-binding transcription factor 4 (Oct4)ForwardCAGACCACCATCTGTCGCTTC
ReverseAGACTCCACCTCACACGGTTCTC

NanogForwardTGCCAGTGATTTGGAGGTGAA
ReverseATTTCACCTGGTGGAGTCACAGAG

Hypoxia-inducible factors 2α (HIF-2α)ForwardCAGTACTCCCACAGGCCTGACTAAC
ReverseGACTGTCACACCGCTGCCATA

CD105ForwardCTGCCAATGCTGTGCGTGAA
ReverseGCTGGAGTCGTAGGCCAAGT

CD44ForwardCAAGCCACTCTGGGATTGGTC
ReverseGGCAAGCAATGTCCTACCACAAC

CD29ForwardCCATGCCAGGGACTGACAGA
ReverseGAGCTTGATTCCAATGGTCCAGA

Stem cell antigen-1 (Sca-1)ForwardTTGCCTTTATAGCCCCTGCT
ReverseGTCATGAGCAGCAATCCACA

Kruppel-like factor 4 (KLF4)ForwardAACATGCCCGGACTTACAAA
ReverseTTCAAGGGAATCCTGGTCTTC

Transcription factor Sp7/osterix (OSX)ForwardAGGCCTTTGCCAGTGCCTA
ReverseGCCAGATGGAAGCTGTGAAGA

Bone sialoprotein (BSP)ForwardGAGACGGCGATAGTTCC
ReverseAGTGCCGCTAACTCAA

Dentin matrix protein 1 (DMP1)ForwardAGTGAGTCATCAGAAGAAAGTCAAGC
ReverseCTATACTGGCCTCTGTCGTAGCC

Microtubule-associated protein 2 (MAP2)ForwardCAGTTTGGCTGAAGGTAGCTGAA
ReverseCACATCTGTGTGAGTGTGTGTGGA

NestinForwardGAGGTGTCAAGGTCCAGGATGTC
ReverseACACCGTCTCTAGGGCAGTTACAA

Nerve growth factor receptor (NGFR)/P75NTRForwardTCTGATGGAGTCGGGCTAATGTC
ReverseCCACAAATGCCCTGTGGCTA

Neuronal differentiation (NeuroD)ForwardCAAAGCCACGGATCAATCTTC
ReverseTGTACGCACAGTGGATTCGTTTC