Table 2: Primers designed for XmnI sequencing.

PrimerSequenceLengthTmGC%

ForwardAAAATTAAGCAGCAGTATCCTCT2348.634.8
ReverseTCCTCCTCTGTGAAATGACC2048.650.0