Thrombosis

Thrombosis / 2014 / Article / Tab 1

Research Article

Study of Associated Genetic Variants in Indian Subjects Reveals the Basis of Ethnicity Related Differences in Susceptibility to Venous Thromboembolism

Table 1

PCR and genotyping details.

GenePolymorphism, regionPrimer detailsPCR product (bp)Annealing temperatureRestriction enzymeBand size (bp)

Factor V Leiden1691 G/A,
rs6025
F: TCAGGCAGGAACAACACCAT
R: GGTTACTTCAAGGACAAAATACCTGTAAAGCT
24158°CHind III G = 241
A = 209, 32

Prothrombin20210G/A, 3′UTR
rs1799963
F: ATTGATCAGTTTGGAGAGTAGGGG
R: AATAGCACTGGGAGCATTGAAGCT
14260°CHind III G = 142
A = 119, 23

TFPI−536C/T, intron7F: TCTATTTTAATTGGCTGTAT
R: GCATGATAATAGTTTCCTGG
17065°CBseN1 C = 170
T = 143, 27

PAI-14G/5G, −675 promoter
rs1799889
F: CACAGAGAGAGTCTGGCCACGT
R: CCAACAGAGGACTCTTGGTCT
9860°CBsl I 4G = 98
5G = 77, 22

PAI-1−844G/A, 3′UTR 
rs2227631
F: CAGGCTCCCACTGATTCTAC
R: GAGGGCTCTCTTGTGTCAAC
51060°CXhoI G = 510
A = 364, 146

MTHFR677C/T,
rs1801133
F: TGAAGGAGAAGGTGTCTGCGGGA
R: AGGACGGTGCGGTGAGA
19862°CHinf I C = 198
T = 175, 23

MTHFR1298A/C,
rs1801131
F: CTTTGGGGAGCTGAAGGACTACTAC
F: CAATTTGTGACCATTCCGGTTTG
16362°CMboII A = 56, 31, 30, 28, 18
C = 84, 31, 30, 18

Fibrinogen-β148C/T, promoter
rs1800787
F: CCTAACTTCCCATCATTTTGTCCAATAAA
R: TGTCGTTGACACCTTGGGACTTAACTAG
36253°CHind III C = 265, 97
T = 362

Fibrinogen-β−455G/A, promoter
rs18000790
F: GCTTGTGGGAAATGAAGGAA
R: GGCAACCACTAAAATCGTGA
46959.5°CHaeIII A = 469, 26
G = 383, 86, 26

PCR1-RFLP details showing primer sequences, PCR product size, annealing temperature, restriction enzyme, digestion temperature, and the fragment sizes.