The Scientific World Journal / 2012 / Article / Tab 1

Research Article

Evidence for Directed Evolution of Larger Size Motif in Arabidopsis thaliana Genome

Table 1

Frequency of occurrence of the various promoter sequences in which spacer sequence length between two ACGT palindromes is gradually increased from 5 to 25 nucleotides.

Cis elementChromosome 1Chromosome 2Chromosome 3Chromosome 4Chromosome 5Total

(ACGT) 2ACGTACGT4693123673274101885
(ACGT) 8 ACGTACGTACGTACGTACGTACGTACGTACGT7031122859200
(ACGT)N5(ACGT)ACGTGGCTAACGT161113131972
(ACGT)N10(ACGT) ACGTGGCTATGGCGACGT851041239
(ACGT)N25(ACGT) ACGTGGCTATGGCGGAGCAAGATTCACTCACGT15121391362
(ACGT)RN5(ACGT) ACGT–GCTAG–ACGT7552423
(ACGT)RN10(ACGT) ACGT–TGGGGCCGAT–ACGT2243314
(ACGT)RN25(ACGT) ACGTAGACACGTTGGGGGAACTTACTGCCACGT3175521
(ACGT)RN25(ACGT) ACGT-ATATGAGATCGGCGCTTCACGGAGC-ACGT41464432
(ACGT)N5(ACGT) randomizedGGAATCCTTGGCA4124301923137
(ACGT)N10(ACGT) randomized GCGGGCTATCGGTAGCAT2520110
(ACGT)N25(ACGT) randomized TAAGGCTTAGCCACGCTTAGGGTGTGAGCACAC6630318
(TGCA)N25(TGCA) TGCAGGCTATGGCGGAGCAAGATTCACTCTGCA1312912955

N5, N10, N25 denote sequence length between two ACGT palindromes. RN5, RN10, RN25—signify only spacer sequence being randomized. (ACGT) N_(ACGT) randomized—signify complete sequence being randomized.

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.