Table 1: List of primers.

Beta-actin primer 1 (sense)5′CGCTACAGCTTCACCACCAC3′
Beta-actin primer 2 (antisense)5′TACTCCTGCTTGCTGATCCAC3′
VIP primer 1 (sense)5′TCCTTGTGCTCCTGACTCTT3′
VIP primer 2 (antisense)5′GACTGCATCTGAGTGACGTT3′
VPAC1 primer 1 (sense)5′CTATGTGCAGATGATCGAGG3′
VPAC1 primer 2 (antisense)5′GAAGAGGTGCATGTGGATGT3′
NKG2D primer 1 (sense)5′TTCTGCTGCTTCATCGCTGT3′
NKG2D primer 2 (antisense)5′GGTGAGAGAATGGAGCCATC3′
DAP10 primer 1 (sense)5′CAGTCCACCATGATCCATCT3′
DAP10 primer 2 (antisense)5′TGCCTGGCATGTTGATGTAG3′
NF-κBp65 primer 1 (sense)5′GAGAGGAGCACAGATACCAC3′
NF-κBp65 primer 2 (antisense)5′CACAGCATTCAGGTCGTAGT3′