The Scientific World Journal / 2013 / Article / Tab 1

Research Article

Human SLC26A1 Gene Variants: A Pilot Study

Table 1

Primers used for PCR and DNA sequencing.

Primer aDirectionSequence (5′ to 3′) bPCR fragment

Primers used for PCR
P1FGCTGAGGCAGGAGAATGGCGTGAAC1
P2RCTGGGGTCCAGGTGTGTGGAATGG1
P3FCAGCTTGGACCAGGCTGGCTCCTTG2
P4RGGATTGGTGCTGGGCCTTCTCCT2
P5FGTAATCCCATCTCACCTCACGATG3
P6RCATCGAGCAGTGGCTGTGAGAGGTAG3
P7FGATGCTCACGTGGATGTCACAGTTG4
P8RCGAACTCTGTGGCATCCTCGTAGAAG4
P9FCACCTGTATGCTGGTCAGCACAGAG5
P10RTGTCCCATTCCTTCCACCTAGAG5
Primers used for sequencing
P11FCCAGGAGGCAGAGCTTCCAG1
P12FGCATATGCACGCACCGGCAGCCTTG1
P13RAGCCTGAGGGTGCCCCTAAGAAACC1
P14RCAAGGAGCCAGCCTGGTCCAAGCTG1
P15FCTGGCTCCTTG CAGGACCAG2
P16FCCATTCCACACACCTGGACCCCAG2
P17RCTTCTCAGCGACGTTAGGCAAAGAC2
P18RCATCGTGAGGTGAGATGGGATTAC2
P19FAGGAGAAGGCCCAGCACCAATCC3
P20FCAAGCACAGGGTTGGCAGAGGAGGTG3
P21RCCTCACCAGCACCTGGCATGG3
P22RTGCCCAAGCCTTGCTGTCTTG3
P23FTTGTCAGGTCCTGTGCCGTGAC4
P24RCTCTGTGCTGACCAGCATACAGGTG4
P25FCTTCTACGAGGATGCCACAGAGTTCG5
P25FATCACACGCAGGACCCAAACACTCAG5
P26RATTCCTTCCACCTAGAGCTGAGG5
P27RCTGAGTGTTTGGGTCCTGCGTGTGAT5

aF: forward primer; R: reverse primer. bPCR fragment denoted in Figure 1(a).

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19.