The Scientific World Journal

The Scientific World Journal / 2014 / Article

Research Article | Open Access

Volume 2014 |Article ID 371045 |

Hongqi Si, Manli Zhao, Xin Zhang, Guoliang Yao, Genlou Sun, Chuanxi Ma, "Cloning and Characterization of Low-Molecular-Weight Glutenin Subunit Alleles from Chinese Wheat Landraces (Triticum aestivum L.)", The Scientific World Journal, vol. 2014, Article ID 371045, 6 pages, 2014.

Cloning and Characterization of Low-Molecular-Weight Glutenin Subunit Alleles from Chinese Wheat Landraces (Triticum aestivum L.)

Academic Editor: Wujun Ma
Received13 Feb 2014
Accepted19 Mar 2014
Published10 Apr 2014


Low-molecular-weight glutenin subunits (LMW-GS) are of great importance in processing quality and participate in the formation of polymers in wheat. In this study, eight new LMW-GS alleles were isolated from Chinese wheat landraces (Triticum aestivum L.) and designated as Glu-A3-1a, Glu-A3-1b, Glu-B3-1a, Glu-B3-1b, Glu-B3-1c, Glu-D3-1a, Glu-D3-1b, and Glu-D3-1c, which were located at the Glu-A3, Glu-B3, and Glu-D3 loci, respectively. Based on the proteins encoded, the number of deduced amino acids of Glu-B3 alleles was approximately 50 more than those of Glu-A3 and Glu-D3 alleles. The first cysteine of Glu-A3 and Glu-D3 alleles was located at the N-terminal domain, while that of Glu-B3 alleles was found in the repetitive domain, which may lead to the different functioning in forming disulfide bonds. All the eight genes were LMW-m types and the new allele of Glu-B3-1a which had nine cysteine residues may be the desirable LMW-GS gene for improving bread-making quality.

1. Introduction

Wheat dough possesses unique viscoelastic properties determined by the structure and interaction of storage proteins in making bread and noodles [1]. Wheat storage proteins are mainly composed of monomeric gliadins and polymeric glutenins [2, 3], and these glutenins are divided into the low-molecular-weight glutenin subunits (LMW-GS) and the high-molecular-weight glutenin subunits (HMW-GS) according to their electrophoretic mobility in sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) [4]. The HMW-GS have been recognized as the major determinants of dough and gluten properties [5], but LMW-GS also play an important role in determining wheat dough’s viscoelastic properties [6].

The LMW-GS genes are encoded by Glu-A3, Glu-B3, and Glu-D3 loci on the short arms of chromosomes 1A, 1B, and 1D, respectively, in hexaploid wheat [7]. Allelic variation in LMW-GS is generally accepted to have an important effect on wheat processing quality [8]. Glu-A3a, Glu-B3d, and Glu-D3a have a better effect on dough strength than other alleles at the Glu-3 loci. The effects of Glu-A3d, Glu-B3i, Glu-A3d, and Glu-B3d contribute most to dough extensibility and Zeleny sedimentation volume, while Glu-D3 loci do not have a significant effect on either [9]. According to He et al. [10], noodle quality is decided by the protein subunits of Glu-A3d and Glu-B3d, and Glu-A3d is significantly more important in this process than other alleles. Si et al. [11] reported that Glu-B3b, Glu-B3g, and Glu-B3h significantly heightened the SDS sedimentation volume, while Glu-B3a, Glu-B3c, and Glu-B3j significantly lowered the SDS sedimentation volume. So far, no consistent conclusion has been reached regarding the influence of LMW-GS allelic variation on wheat processing quality, perhaps due to the different materials used, and the interaction between genotypes and the environment.

Although the mobility of many LMW-GS subunits is very similar and sometimes overlapped with each other in SDS-PAGE, a lot of researches have recently been conducted on LMW-GS genes by allelic-specific polymerase chain reaction (PCR) in common wheat and related species [1214], which lead to a better understanding of the function, structure, and diversity of LMW-GS.

The landraces possess many useful traits that have been lost in modern cultivars. The phenological, morphological, physiological, and quality traits in landraces are genetically diverse [15]. Although more than 15 LMW-GS genes have been found so far in wheat [16], further studies of the diversity of these LMW-GS genes and cloning of new and rare alleles are interesting and challenging. In this study, we isolated and characterized eight new alleles located at Glu-A3, Glu-B3, and Glu-D3 loci from landraces for which no LMW-GS genes have been previously detected by the corresponding molecular markers [1719].

2. Materials and Methods

2.1. Plant Materials

The landraces Jiangdongmen, Daqingmang, Hongjinbaoyin, Dabaimai, Hongmangzi, Hongdougou, and Baimangmai used in this study were kindly provided by the National Gene Bank of China, Institute of Crop Science, CAAS, China. In our previous research, none of the LMW-GS genes were detected in the varieties Daqingmang and Hongjinbaoyin using the PCR markers for Glu-A3 [17] alleles, the Glu-B3 [18] alleles from the varieties Hongdougou, Dabaimai, and Hongmangzi, or the Glu-D3 [19] alleles from the varieties Jiangdongmen, Daqingmang, and Baimangmai. To determine whether the genes at the Glu-A3, Glu-B3, and Glu-D3 loci corresponding to the above varieties are missing or whether it is a novel gene, we used locus-specific primers to amplify the LMW-GS genes specifically for the Glu-A3, Glu-B3, and Glu-D3 loci.

2.2. Genomic DNA Extraction and PCR Amplification

Genomic DNA was isolated from single dry seeds according to the procedure of SDS-phenol-chloroform with minor modification. Six locus-specific primer sets, Glua3f1/Glua3r2 (R: GTACGCTTTTGTAGCTTGTGC, F: GATGCCAACGCCTAATGGCACAC) [17], 5/7 (R: TCCTGAGAAGTGCATGACATG, F: GTAGGCACCAACTCCGGTGC) [20], and 3/4 (R: TTGTAGAAACTGCCATCCTT, F: GTCACCGCTGCATCGACATA) [20], were used for amplifying LMW-GS genes at the Glu-A3 locus on chromosome 1A and the Glu-B3 and Glu-D3 loci on chromosomes 1B and 1D, respectively. The locus-specific primers were synthesized by Shanghai Sangon Biological Engineering & Technology and Service Ltd. ( PCR amplification was performed using Ex Taq DNA polymerase (0.5 U, TaKaRa, Shiga, Japan) in 10 μL of 1x PCR buffer (comprising 2 mM MgCl2; TaKaRa) containing 50 ng genomic DNA, 0.1 mM dNTP, and 20 μM of each primer. The PCR conditions were 94°C for 5 min followed by 38 cycles at 94°C for 1 min (or 35 s for primer pair 3/4 at 52°C, 5/7 at 54°C, and Glua3f1/Glua3r2 at 59°C), followed by 72°C for 90 s and a final extension at 72°C for 10 min.

2.3. DNA Cloning and Sequencing of LMW-GS Genes

The PCR products were separated using 1.2% agarose gels and the expected fragments were isolated from the gels using an EasyPure Quick Gel Extraction Kit (TransGen, Beijing, China). The isolated PCR products were cloned into the pMD18-T Simple Vector (TaKaRa) and transformed into E. coli Competent Cells DH5α (TaKaRa). The positive colonies were verified using M13 universal primers, and the selected clones were sequenced by Shanghai Sangon Biological Engineering & Technology and Service Ltd. Each PCR and sequencing analysis was repeated at least three times to avoid technical errors.

2.4. Accession Numbers

The LMW-GS gene sequences identified from Jiangdongmen, Daqingmang, Hongjinbaoyin, Dabaimai, Hongmangzi, Hongdougou, and Baimangmai were deposited in GenBank under accession numbers KF020658–KF020665. KF020658 and KF020659 were cloned using Glu-A3 locus-specific primers from Daqingmang and Hongjinbaoyin, designated as Glu-A3-1a and Glu-A3-1b, respectively. The sequences KF020660–KF020662 were cloned using Glu-B3 locus-specific primers from Hongdougou, Dabaimai, and Hongmangzi, designated as Glu-B3-1a, Glu-B3-1b, and Glu-B3-1c, respectively, and KF020663–KF020665 were cloned using Glu-D3 locus-specific primers from Jiangdongmen, Daqingmang, and Baimangmai, designated as Glu-D3-1a, Glu-D3-1b, and Glu-D3-1c, respectively.

2.5. LMW-GS Gene Analysis

Sequence analysis and characterization were performed using DNAMAN software (, BLAST tools at NCBI (, and the PlantCare database ( The nomenclature of the LMW-GS genes followed the “Catalogue of Gene Symbols for Wheat” at

3. Results and Discussion

3.1. Basic Characteristics of the LMW-GS Alleles Identified in This Study

Eight novel LMW-GS alleles with no intron were obtained in this study (see Figure S1 in Supplementary Material available online at Their sequences were submitted to GenBank with the accession numbers KF020658–KF020665 and designated as Glu-A3-1a, Glu-A3-1b, Glu-B3-1a, Glu-B3-1b, Glu-B3-1c, Glu-D3-1a, Glu-D3-1b, and Glu-D3-1c, following the nomenclature rules at Glu-A3-1a and Glu-A3-1b had the same size of 1089 bp and could be translated into 298 amino acids. The nucleotide and deduced amino acid sequences of the other six genes were varied with 1361–1603 bp and 306–351 residues (Table 1). The upstream nucleotide sequences of the cloned genes were searched for in the PlantCare database to analyze the characteristics of the promoter sequences. The eight genes all contained CAAT-boxes and TATA-boxes. Glu-B3-1a, Glu-B3-1b, Glu-B3-1c, Glu-D3-1a, Glu-D3-1b, and Glu-D3-1c contained a Prolamin-box in the upstream sequence (Table 1). All eight genes from landraces in our study belonged to the LMW-m type since their first amino acid at the N-terminal was methionine.

LMW-GS genesUpstreamCDSTotal lengthDeduced amino acidsPutative transcription binding sites in the upstream region

Glu-A3-1a 195 bp894 bp1089 bp298CAAT-box, TATA-box, ARE, and MRE
Glu-A3-1b 195 bp894 bp1089 bp298CAAT-box, TATA-box, ARE, and MRE
Glu-B3-1a 317 bp1053 bp1370 bp351CAAT-box, TATA-box, and Prolamin-box
Glu-B3-1b 317 bp1044 bp1361 bp348CAAT-box, TATA-box, and Prolamin-box
Glu-B3-1c 317 bp1050 bp1367 bp350CAAT-box, TATA-box, and Prolamin-box
Glu-D3-1a 593 bp921 bp1591 bp307CAAT-box, TATA-box, and Prolamin-box
Glu-D3-1b 605 bp921 bp1603 bp307CAAT-box, TATA-box, and Prolamin-box
Glu-D3-1c 605 bp912 bp1594 bp306CAAT-box, TATA-box, and Prolamin-box

3.2. Nucleotide Comparison Analysis of the LMW-GS Alleles within the Glu-3 Loci

To more accurately compare the differences between LMW-GS genes at the Glu-3 loci, we used BLAST tools to find the sequences most similar to the eight genes obtained in this study. Nine Glu-3 genes deposited in GenBank were selected for multiple sequence alignment and included FJ549937, FJ549938, and FJ549946 located at the Glu-A3 locus; EU369729, EU369730, and DQ630441 at the Glu-B3 locus; and DQ357054, DQ357055, and EU189094 at the Glu-D3 locus. Based on the results of these alignments (Table 2), of the eight genes isolated in this study, Glu-A3-1a, and Glu-A3-1b were found to be new alleles at the Glu-A3 locus; Glu-B3-1a, Glu-B3-1b, and Glu-B3-1c were new alleles at the Glu-B3 locus; and Glu-D3-1a, Glu-D3-1b, and Glu-D3-1c were new alleles at the Glu-D3 locus.

LMW-GS allelesGlu-A3 gene accession numberGlu-B3 gene accession numberGlu-D3 gene accession number

Glu-A3-1a 939292848484878787
Glu-A3-1b 939291838383868687
Glu-B3-1a 858585958484838383
Glu-B3-1b N8586998585848485
Glu-B3-1c N8586998585838384
Glu-D3-1a 878888888585959594
Glu-D3-1b 868787838282999999
Glu-D3-1c 878787848282999999

Note: N means that no highly similar sequences were found using BLAST tools.
3.3. Deduced Proteins Comparison Analysis of the LMW-GS Alleles within the Glu-3 Loci

The deduced amino acid sequences of the eight genes comprised four structural regions, including a signal peptide of 20 amino acids, a conserved N-terminal region of 13 amino acids, a diverse repetitive domain, and a C-terminal domain, suggesting that the eight genes conformed to the typical molecular characteristics of LMW-GS (Supplementary Material, Figure S2). We compared the alleles within the Glu-3 loci and found that isoleucine was at the sixth position of the signal peptide in the allele located at Glu-B3 locus, while valine was at the Glu-A3 and Glu-D3 loci (Table 3), which might result from the substitution of ATC for GTC (Supplementary Material, Figure S1). The eleventh position of the N-terminal at the Glu-A3 and Glu-D3 loci was arginine, while lysine filled the same position at the Glu-B3 locus (Table 3), which may be the result of an transversion (Supplementary Material, Figure S1).





The accession numbers are as follows: FJ549937, FJ549938, and FJ549946 are genes at the Glu-A3 locus; EU369729, EU369730, and DQ630441 are genes at the Glu-B3 locus; and DQ357054, DQ357055, and EU189094 are genes at Glu-D3 locus. I, V, R, K, and C represent isoleucine, valine, arginine, lysine, and cysteine, respectively.

Eight cysteine residues were found in Glu-A3-1a, Glu-A3-1b, Glu-B3-1b, Glu-B3-1c, Glu-D3-1a, Glu-D3-1b, and Glu-D3-1c, while Glu-B3-1a had nine. By comparing the Glu-3 loci alleles, the locations of the first and seventh cysteine were found to be varied. As shown in Figure S2 (Supplementary Material) and Table 3, the first cysteine of the Glu-A3 and Glu-D3 alleles was located at the fifth position of the N-terminal domain, whereas the first cysteine of the Glu-B3 alleles was found at the 46th position of the deduced amino acid sequences in the repetitive domain. The seventh cysteine at the Glu-D3 alleles was located 16 amino acids higher up than that at the Glu-A3 and Glu-B3 alleles. In particular, the extra cysteine of allele Glu-B3-1a was found at the 321st position of the amino acid sequence.

Usually the first and seventh cysteine residues participate in forming the intermolecular disulfide bond, while the remaining residues participate in the formation of intramolecular disulfide bonds [21]. Disulfide bonds have an important influence on determining the properties and structure of wheat gluten proteins [22]. The first cysteine at the Glu-B3 allele was in the repetitive domain, however, the first cysteine at Glu-A3 and Glu-D3 alleles were in the N-terminal. The positions of the seventh cysteine residue at the Glu-D3 alleles were also different from the Glu-A3 and Glu-B3 alleles. The LMW-GS gene, which had nine cysteine residues, resulted in desirable processing quality [20]; therefore, the new allele of Glu-B3-1a may be the desirable LMW-GS gene for improving bread-making quality because the extra cysteine residue could form more disulfide bonds than other alleles during the development of glutenin macropolymer.

Insertions/deletions often appeared within the repetitive domain. The length variation of the LMW-GS genes was mainly due to the numbers of repeat motifs, which ranged from 12 to 25 in the repetitive domain. The repeat motif is shown in Table 4. Two long insertions were present in the Glu-B3 sequences, that is, 18 amino acid insertions at positions 44–61 and eight amino acid insertions at positions 81–88. The repetitive region was composed of a representative repeat motif , of which the number would have an impact on changes in the length of the protein [23]. The length of the diverse repetitive domain of Glu-B3 alleles was longer than those of Glu-A3 and Glu-D3 alleles since more insertions occurred in this domain. Masci et al. [24] indicated that a 42 K LMW-GS would have a good processing quality due to its large repeat domain. The repeat domain through intermolecular interactions between large numbers of glutamine side chains, which are both good hydrogen bond donors and acceptors, may prove useful in increasing the viscosity and elasticity of wheat dough [24]. More repeat motifs in the repetitive domain would lead to a better flour quality [25]. Based on Figure S2 (Supplementary Material), the sequences at the Glu-B3 locus had 50 more deduced amino acids than those at Glu-A3 and Glu-D3 loci. Therefore, genes at the Glu-B3 locus are more desirable than those at the Glu-A3 and Glu-D3 loci.

Glu-A3-1a Glu-A3-1b Glu-B3-1a Glu-B3-1b Glu-B3-1c Glu-D3-1a Glu-D3-1b Glu-D3-1c


4. Conclusion

This study showed that, of the eight new Glu-3 alleles added to the LMW-GS gene family, Glu-B3-1a had nine cysteine residues and the others had eight. The first cysteine of Glu-A3 and Glu-D3 alleles was found in the N-terminal domain, while it was located at the repetitive domain of Glu-B3 alleles. The LMW-GS allele of Glu-B3-1a can be used as candidate gene for improving bread-making quality because it can form more disulfide bonds.

Conflict of Interests

All authors declare that they have no conflict of interests regarding the publication of this paper.


This work was supported by Grants from the National Key Technologies R&D Program (2011BAD35B03), the China Agriculture Research System (CARS-03), the National 863 Program (2012AA101105), the Anhui Provincial Science and Technology Program (1201a0301010), and the Collaborative Innovation Center of Food Crops in Anhui Province.

Supplementary Materials

The supplementary material reported multiple alignments of nucleotide and deduced amino acid sequences of the eight cloned genes, named Figure S1 and Figure S2 respectively.

  1. Supplementary Materials


  1. T. Dutta, H. Kaur, S. Singh et al., “Developmental changes in storage proteins and peptidyl prolyl cis-trans isomerase activity in grains of different wheat cultivars,” Food Chemistry, vol. 128, no. 2, pp. 450–457, 2011. View at: Publisher Site | Google Scholar
  2. P. Chen, R. Li, R. Y. Zhou, E. Zhiguo, and G. Y. He, “Cloning and characterization of novel low molecular weight glutenin subunit genes from two Aegilops species with the C and D genomes,” Genetic Resources and Crop Evolution, vol. 57, no. 6, pp. 881–890, 2010. View at: Publisher Site | Google Scholar
  3. X. An, Q. Zhang, Y. Yan et al., “Cloning and molecular characterization of three novel LMW-i glutenin subunit genes from cultivated einkorn (Triticum monococcum L.),” Theoretical and Applied Genetics, vol. 113, no. 3, pp. 383–395, 2006. View at: Publisher Site | Google Scholar
  4. H. Tanaka, S. Toyoda, and H. Tsujimoto, “Diversity of low-molecular-weight glutenin subunit genes in Asian common wheat (Triticum aestivum L.),” Breeding Science, vol. 55, no. 3, pp. 349–354, 2005. View at: Publisher Site | Google Scholar
  5. Y. Popineau, M. Cornec, J. Lefebvre, and B. Marchylo, “Influence of high Mr glutenin is subunits on glutenin polymers and rheological properties of glutens and gluten subfractions of near-isogenic lines of wheat sicco,” Journal of Cereal Science, vol. 19, no. 3, pp. 231–241, 1994. View at: Publisher Site | Google Scholar
  6. X. F. Zhang, D. C. Liu, W. Jiang et al., “PCR-based isolation and identification of full-length low-molecular-weight glutenin subunit genes in bread wheat (Triticum aestivum L.),” Theoretical and Applied Genetics, vol. 123, no. 8, pp. 1293–1305, 2011. View at: Publisher Site | Google Scholar
  7. N. K. Singh and K. W. Shepherd, “Linkage mapping of genes controlling endosperm storage proteins in wheat,” Theoretical and Applied Genetics, vol. 75, no. 4, pp. 628–641, 1988. View at: Publisher Site | Google Scholar
  8. C. Luo, W. B. Griffin, G. Branlard, and D. L. McNeil, “Comparison of low- and high molecular-weight wheat glutenin allele effects on flour quality,” Theoretical and Applied Genetics, vol. 102, no. 6-7, pp. 1088–1098, 2001. View at: Publisher Site | Google Scholar
  9. G. Branlard, M. Dardevet, R. Saccomano, F. Lagoutte, and J. Gourdon, “Genetic diversity of wheat storage proteins and bread wheat quality,” Euphytica, vol. 119, no. 1-2, pp. 59–67, 2001. View at: Publisher Site | Google Scholar
  10. Z. H. He, L. Liu, X. C. Xia, J. J. Liu, and R. J. Pena, “Composition of HMW and LMW glutenin subunits and their effects on dough properties, pan bread, and noodle quality of Chinese bread wheats,” Cereal Chemistry, vol. 82, no. 4, pp. 345–350, 2005. View at: Publisher Site | Google Scholar
  11. H. Si, M. Zhao, F. He, and C. Ma, “Effect of Glu-B3 allelic variation on sodium dodecyl sulfate sedimentation volume in common wheat (Triticum aestivum L.),” The Scientific World Journal, vol. 2013, Article ID 848549, 5 pages, 2013. View at: Publisher Site | Google Scholar
  12. Q. X. Lan, B. Feng, Z. M. Xu, G. J. Zhao, and T. Wang, “Molecular cloning and characterization of five novel low molecular weight glutenin subunit genes from Tibetan wheat landraces (Triticum aestivum L.),” Genetic Resources and Crop Evolution, vol. 60, no. 2, pp. 799–806, 2013. View at: Publisher Site | Google Scholar
  13. S. L. Wang, D. Chen, G. F. Guo et al., “Molecular Characterization of LMW-GS Genes from C, N, U and Ss genomes among Aegilops Species,” Cereal Research Communications, vol. 40, no. 4, pp. 542–551, 2012. View at: Publisher Site | Google Scholar
  14. S. L. Wang, K. Wang, G. X. Chen et al., “Molecular characterization of LMW-GS genes in Brachypodium distachyon L. reveals highly conserved Glu-3 loci in Triticum and related species,” BMC Plant Biology, vol. 12, article 221, 2012. View at: Google Scholar
  15. A. Cherdouh, D. Khelifi, J. M. Carrillo, and M. T. Nieto-Taladriz, “The high and low molecular weight glutenin subunit polymorphism of Algerian durum wheat landraces and old cultivars,” Plant Breeding, vol. 124, no. 4, pp. 338–342, 2005. View at: Publisher Site | Google Scholar
  16. X. Zhang, D. Liu, J. Zhang et al., “Novel insights into the composition, variation, organization, and expression of the low-molecular-weight glutenin subunit gene family in common wheat,” Journal of Experimental Botany, vol. 64, no. 7, pp. 2027–2040, 2013. View at: Publisher Site | Google Scholar
  17. W. Zhang, M. C. Gianibelli, L. R. Rampling, and K. R. Gale, “Characterisation and marker development for low molecular weight glutenin genes from Glu-A3 alleles of bread wheat (Triticum aestivum L),” Theoretical and Applied Genetics, vol. 108, no. 7, pp. 1409–1419, 2004. View at: Publisher Site | Google Scholar
  18. L. H. Wang, X. L. Zhao, Z. H. He et al., “Characterization of low-molecular-weight glutenin subunit Glu-B3 genes and development of STS markers in common wheat (Triticum aestivum L.),” Theoretical and Applied Genetics, vol. 118, no. 3, pp. 525–539, 2009. View at: Publisher Site | Google Scholar
  19. X. L. Zhao, X. C. Xia, Z. H. He et al., “Novel DNA variations to characterize low molecular weight glutenin Glu-D3 genes and develop STS markers in common wheat,” Theoretical and Applied Genetics, vol. 114, no. 3, pp. 451–460, 2007. View at: Publisher Site | Google Scholar
  20. H. X. Zhao, A. G. Guo, S. W. Hu et al., “Development of primers specific for LMW-GS genes at Glu-D3 and Glu-B3 loci and PCR amplification,” Acta Agronomica Sinica, vol. 30, no. 2, pp. 126–130, 2004. View at: Google Scholar
  21. E. J. L. Lew, D. D. Kuzmicky, and D. D. Kasarda, “Characterization of low molecular weight glutenin subunits by reversed-phase high-performance liquid chromatography, sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and N-terminal amino acid sequencing,” Cereal Chemistry, vol. 69, no. 5, pp. 508–515, 1992. View at: Google Scholar
  22. P. R. Shewry and A. S. Tatham, “Disulphide bonds in wheat gluten proteins,” Journal of Cereal Science, vol. 25, no. 25, pp. 207–227, 1997. View at: Google Scholar
  23. B. G. Cassidy, J. Dvorak, and O. D. Anderson, “The wheat low-molecular-weight glutenin genes: characterization of six new genes and progress in understanding gene family structure,” Theoretical and Applied Genetics, vol. 96, no. 6-7, pp. 743–750, 1998. View at: Publisher Site | Google Scholar
  24. S. Masci, R. D'Ovidio, D. Lafiandra, and D. D. Kasarda, “A 1B-coded low-molecular-weight glutenin subunit associated with quality in durum wheats shows strong similarity to a subunit present in some bread wheat cultivars,” Theoretical and Applied Genetics, vol. 100, no. 3-4, pp. 396–400, 2000. View at: Publisher Site | Google Scholar
  25. S. Masci, R. D'Ovidio, D. Lafiandra, and D. D. Kasarda, “Characterization of a low-molecular-weight glutenin subunit gene from bread wheat and the corresponding protein that represents a major subunit of the glutenin polymer,” Plant Physiology, vol. 118, no. 4, pp. 1147–1158, 1998. View at: Google Scholar

Copyright © 2014 Hongqi Si et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

More related articles

 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder

Related articles