Isolation and Identification of Endophytic Fungi from <i>Syzygium cumini</i> Linn and Investigation of Their Pharmacological Activities

Samapti, Mst. Mabiya Sultana; Afroz, Farhana; Rony, Satyajit Roy; Sharmin, Suriya; Moni, Fatema; Akhter, Shammi; Ahmed, Sheikh Feroz Uddin; Sohrab, Md. Hossain

doi:https://doi.org/10.1155/2022/9529665

The Scientific World Journal

On this page

Abstract Introduction Materials and Methods Results Discussion Conclusions Data Availability Conflicts of Interest Acknowledgments References Copyright Related Articles

Research Article | Open Access

Volume 2022 | Article ID 9529665 | https://doi.org/10.1155/2022/9529665

Isolation and Identification of Endophytic Fungi from Syzygium cumini Linn and Investigation of Their Pharmacological Activities

Mst. Mabiya Sultana Samapti,^1,2Farhana Afroz,¹Satyajit Roy Rony,¹Suriya Sharmin,¹Fatema Moni,¹Shammi Akhter,¹Sheikh Feroz Uddin Ahmed,²and Md. Hossain Sohrab¹

Academic Editor: Mustafa Sevindik

Received31 Jul 2022

Accepted21 Oct 2022

Published03 Nov 2022

Abstract

This study was conducted to isolate and identify the endophytic fungi from the bark and leaves of the Syzygum cumini plant and investigate the pharmacological activities of endophytic fungi along with plant parts. After isolation, endophytic fungi were identified based on morphological characteristics and molecular identification. Antimicrobial, antioxidant, and cytotoxic activities were studied by a disc diffusion method, free radical scavenging DPPH assay, and brine shrimp lethality bioassay, respectively. A total of eight endophytic fungi were isolated and identified up to the genus level based on morphological characteristics and confirmed by molecular identification techniques. Among the eight isolates, three isolates were identified as Colletotrichum sp. (SCBE-2, SCBE-7, and SCLE-9), while the rest of the isolates belonged to Diaporthe sp. (SCBE-1), Pestalotiopsis sp. (SCBE-3), Penicillium sp. (SCBE-4), Phyllosistica sp. (SCLE-7), and Fusarium sp. (SCLE-8). The presence of flavonoids, anthraquinones, coumarins, and isocoumarins was assumed by the preliminary screening of the fungal and plant extracts by a thin-layer chromatographic technique under UV light. Fungal extracts of Pestalotiopsis sp. Penicillium sp. were found sensitive to all test bacteria, but only extracts from the leaf and bark showed significant antifungal activity along with their antimicrobial activity. Penicillium sp. The fungal extract showed the highest free radical scavenging activity (2.43 μg/mL) near that of ascorbic acid (2.42 μg/mL). Some fungal extracts showed cytotoxic activity that, in general, suggests their probable abundance of biological metabolites. This is the first approach to investigate the endophytic fungi of Syzygium cumini Linn. in Bangladesh, to find the pharmacological potential of endophytes, and to explore novel compounds from those endophytes.

1. Introduction

Mankind always rely on nature, especially when it comes to find new drugs to cure diseases [1]. The need for safe, chemical free, and less toxic treatment options has prompted the search for innovative and enhanced ways to deal with these health-related problems. To serve this purpose, several medicines including antioxidants, antidiabetic drugs, anti-inflammatory agents, antiulcer agents, antibiotics, and antifungal agents have been discovered from different sources like medicinal plants, edible and medicinal higher fungi (mushrooms), microbial sources like fungus, bacteria, and endophytes [2–6]. Recently, many known as well as new endophytic bioactive metabolites have been identified as possessing a wide variety of pharmacological activities such as antibiotic, antiviral, anticancer, anti-inflammatory, and antioxidant [7]. So, endophytes associated with plants may be considered a source of novel compounds [8]. Endophytes are microbes that are present in internal plant tissues without inducing symptomatic infection in their host plant. Endophytic fungi have contributed to their host plants by developing bioactive compounds that provide protection to the plant [9, 10]. In each plant, one or more endophytes can reside, so plants provide a rich microorganism repository [11, 12]. In this study, Syzygium cumini has been used for investigation. Syzygium cumini (Syn. Eugenia jambolana), also known as jamun or black plum, belongs to the family Myrtaceae [13]. The entire plant parts such as seed, fruit, leaves, flower, and bark are widely used in folk medicine like Ayurveda, Unani [14, 15]. Studies have shown that various extracts of jamun exhibits pharmacological effects such as anti-inflammatory, antifungal, antiviral, anti-inflammatory, antiulcerogenic, cardioprotective, antiallergic, anticancer, radio protective, antioxidant, and hepatoprotective properties [8]. So, endophytes residing in Syzygium cumini may contain a lot of biologically active metabolites. Therefore, the present study was designed to investigate the pharmacological potential of endophytic fungi isolated from the Syzygium cumini plant to explore some novel drug candidates as well as to compare them with the plant extract.

2. Materials and Methods

2.1. Collection of Plant Material and Isolation of Endophytes

The plant sample Syzygium cumini Linn was collected from the Jahangirnagar University botanical garden in November, 2018. It was identified by the taxonomist of the Bangladesh National Herbarium, Dhaka, Bangladesh. A voucher specimen (DACB-47653) has been deposited in the Herbarium for further reference. Leaves and barks from healthy and mature plants were randomly collected for the study. The plant material was carried to the laboratory in sterile bags and processed within a few hours after sampling. They were then cut with an anti-cutter, over a sterile glass plate. Endophytic fungi were isolated from the fresh plant parts following the procedure and suitably modified [16–18].

2.2. Morphological Identification of Endophytic Fungus

To identify the isolates of endophytic fungus, slides prepared from cultures were stained with a lactophenol cotton blue reagent and then examined with a bright-field and phase contrast microscope [19]. Their morphological identification was completed based on the growth pattern, hyphae, the color of the colony and medium, surface texture, margin character, aerial mycelium, sporulation and production of acervuli, the coloration of the medium, and the size and coloration of the conidia using standard identification manuals [20].

2.3. Molecular Identification

The molecular identification of fungal strains was completed by DNA amplification and sequencing of the internal transcribed spacer (ITS) region using the molecular biological protocol [21, 22]. A segment of fungal hyphae (0.5–1.0 cm²) was collected from the Petri dish and lyophilized in an Eppendorf tube (2 mL) (Eppendorf, Germany). The lyophilized fungal mycelia were pulverized and the infection was disrupted. Fungal DNA isolation was achieved according to the manufacturer’s protocol by using the DNeasy Plant Mini Package (QIAgen, USA). The procedures include cell lysis, RNA digestion by RNase A, removal of precipitates and cell waste, DNA shearing, precipitation, and purification. Then, the isolated DNA was amplified by polymerase chain reaction (PCR). The PCR was performed using the Master Mix Kit of HotStarTaq (QIAgen, USA). As primers, ITS 1 (with TCCGTAGGTGAACCTGCGG base sequences) and ITS4 (with TCCTCCGCTTATTGATGATGC base sequences) (Invitrogen, USA) were mixed with the HotStarTaq Master Mix Kit and DNA template with a total volume of 50 μL. The mixture was then added to the thermal cycler using the programmed PCR (BioRad, USA). The amplified fungal DNA (PCR product) was then submitted by a commercial service for sequencing and the base sequence was compared using BLAST Algorithm with publicly accessible databases, including GenBank.

2.4. Endophytic Fungal Cultivation and Extraction

Small scale cultivation was performed on Petri dishes for the isolated fungal strains with approximately 1 L of PDA media for each strain. Endophytic isolates were incubated for 21 days at 28°C and the culture media were extracted two times with ethyl acetate to obtain the crude extracts [17]. The extracts of the fungi were concentrated into a solid residue by evaporation with a rotary vacuum evaporator under reduced pressure to obtain an ethyl acetate crude extract [23].

2.5. Preliminary Chemical Analysis

All the extracts, including fungal and plant, were qualitatively tested for the presence of chemical constituents. The screening of extracts was performed by visual detection, UV light (both in short at 254 nm and in long at 365 nm), and vanillin-H₂SO₄ spray reagent [17].

2.6. Antioxidant Activity

The antioxidant activity of extracts was estimated using the 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical scavenging method. 2.0 mL of methanol solution of the extract at different concentrations was mixed with 2.0 mL of a DPPH methanol solution (20 μg/mL). Samples were placed in a dark place at room temperature for 30 min to complete the reaction. Then, the absorbance was measured at 517 nm against methanol as blank by a UV spectrophotometer using the method described by Brand Williams [24]. For each sample, the result was presented as an IC₅₀. Ascorbic acid (AA) and 2-tert-butyl-4-hydroxyanisole (BHA) were used as positive controls.

Inhibition of free radical DPPH in percent (I%) was calculated as follows:

2.7. Antimicrobial Activity Test

Antibacterial and antifungal activities of the fungus and plant parts were analyzed by using a slightly modified disc diffusion method using four pathogenic bacterial strains, namely, Staphylococcus aureus ATCC 25923, Escherichia coli ATCC25922, Bacillus megaterium ATCC 13578, and Pseudomonas aeruginosa ATCC 27833 and one fungal strain, Aspergillus Niger [25]. Kanamycin sensitivity disc (30 μg/disc) was used as a positive control for bacteria, whereas ketoconazole disc (30 μg/disc) for fungi. Solvents are used as a negative control. The zones of growth inhibition around the discs were measured after 18 to 24 hours of incubation at 37°C for bacteria and 48 to 96 hours of incubation at 28°C for fungi. The sensitivity of the test agent to the microorganisms is determined by measuring the diameter of the zone of inhibition expressed in millimeters.

2.8. Brine Shrimp Lethality Bioassay

The eggs of brine shrimp nauplii (Artemia salina) were commercially collected from a pet shop for the brine shrimp lethality bioassay, hatched for 24 hours, and tested for LC₅₀ values against varying concentrations (200–0.39 μg/mL) of dimethylsulfoxide (DMSO) fungal extracts obtained by the serial dilution technique [26]. Vincristine sulfate was used as a positive control and DMSO was used both as a solvent and as a negative control. All the samples were tested in triplicate.

3. Results

3.1. Morphological Identification of Fungal Isolates

A total of eight endophytic fungi were isolated from the bark and leaf parts of the plant Syzygium cumini. They have been coded as internal strain numbers, namely, SCBE-1, SCBE-2, SCBE-3, SCBE-4, SCBE-7, SCLE-7, SCLE-8, and SCLE-9. The microscopic characters of strain SCBE-1 produced woolly to cottony, whitish, pale to light brown mycelium, conidiophores that were simple. Two types of conidia were observed upon microscopic examination. The alpha (α) conidia were hyaline, fusiform to ovate, straight, aseptate, and frequently biguttulate. The beta (β) conidia were filiform, sigmoidal, and hyalinase arising from the mycelium. These characteristics indicated that the fungus SCBE-1 belongs to Diaporthe sp. (Figure 1). Strains SCBE-2, SCBE-7, and SCLE-9 showed profusely branched, septate, and hyaline mycelium. Simple, elongated, disc-shaped, or cushion-shaped conidiophores were also found. Conidia were hyaline, single-celled, and ovoid to oblong in shape. This fungus developed quickly, usually covering the entire Petri dish in 10 days and sporulation was abundant on PDA media. These characteristics indicated that the fungi belong to Colletotrichum sp. (Figure 1). Their morphology was different and supposed to belong to different species. Strain SCBE-3 was characterized as Pestalotia sp. for the presence of white colour mycelium and dark, discoid, or cushion-shaped acervuli. Conidiophores (annellides) were present within tight fruiting structures (aecervuli or pycnidia). Spores (conidia) were 4- to 5-celled, with two or three dark brown center cells (Figure 1). Strain SCBE-4 showed hyaline, fluffy, colored, branched, and septate mycelium. Conidia was arising singly or less often in synnemata from the mycelium, branched near the apex to form a brash like, ending in phialides, eventually turned into green and granular spores, one celled, ovoid. This characteristic indicated that the fungus SCBE-4 belongs to Penicillium sp. (Figure 1). In the case of SCLE-7, pycnidia were dark, ostilate, lenticular to globose, which were immersed in the host tissue. Short or obsolete conidiophores were observed. Conidia were small, 1-celled, hyaline, ovoid to elongated. So, SCLE-7 was characterized as Phyllosistica sp. (Figure 1). SCLE-8 produced sparse to abundant cottony mycelium with white violet mycelium and pigmentation from colorless to pale violet. Conidia or phialo spore’s hyaline, two kinds of spores were observed. Macroconidia were multicellular organisms with a pointed end that was slightly curled or bent. Microconidia were one-celled and oblong in shape, with a fluffy colony and spores that were cylindrical, septate, and aseptate. So, strain SCLE-8 was identified as Fusarium sp. (Figure 1).

3.2. Molecular Identification of Fungal Isolates

The identification of isolated strains SCBE-1, SCBE-2, SCBE-3, SCBE-4, SCBE-7, SCLE-7, SCLE-8, and SCLE-9 was further confirmed by DNA sequence analysis based on mega BLAST software at the U. S. National Centre for Biotechnology Information (NCBI). Among the eight isolates, three isolates were identified as Colletotrichum sp. (SCBE-2, SCBE-7, and SCLE-9) while the rest of the isolates were Diaporthe sp. (SCBE-1), Pestalotiopsis sp. (SCBE-3), Penicillium sp. (SCBE-4), Phyllosistica sp. (SCLE-7), and Fusarium sp. (SCLE-8).

The high-quality DNA extracted from endophytic fungi used ITS1 and ITS4 as primers for PCR. The genomic DNA of the fungi that successfully amplified SCBE-1 and SCBE-2 isolates had a length of 625 bp; the SCBE-3 and SCBE-4 isolates had a length of 600 bp, while the SCBE-7, SCLE-7, SCLE-8, and SCLE-9 isolate had a length of 550 bp (Figure 2). Their detailed description of GenBank accession number of closely related fungal strains, along with their similarity and family is summarized in Table 1.

3.3. Preliminary Screening

A thin-layer chromatographic technique was conducted to determine the presence of various secondary metabolites. The screening of extracts was performed by visual detection, UV light (both in short at 254 nm and in long at 365 nm), and vanillin-H₂SO₄ spray reagent and presented in a tabular form (Table 2). This result indicates the presence of a good number of compounds like flavonoids, terpenoids, steroids, coumarins, isocoumarins, anthraquinone, etc., which are depicted in a tabular form.

3.4. Antimicrobial Screening of Endophytic Fungi from Syzygium cumini

For screening of antibacterial activity, all the extracts obtained from endophytic fungi and the plant samples were tested at 100 μg/disc concentration. The zone of inhibition produced by the fungal and plant extracts was found to be 7–22 mm. Leaf extract of Syzygium cumini plant exhibited significant antimicrobial activity against Escherichia coli (18 mm), good activity against Salmonella typhi (15 mm), moderate activity against Bacillus megaterium (13 mm), and poor activity against Staphylococcus aureus (7 mm). It demonstrated significant antifungal activity against Aspergillus niger (22 mm), which is higher than the standard ketoconazole (18 mm). The bark extract also showed mild activity against S. typhi (10 mm). On the other hand, its zone of inhibition against A. Niger was 18 mm. The extract of Penicillium sp. (SCBE-4) was found to be sensitive to all test bacteria, exhibiting good activity against E. coli (15 mm), S. typhi (16 mm), S. aureus (15 mm) and mild activity against B. megaterium (10 mm). Also, an extract of Pestalotiopsis sp. (SCBE-3) was found sensitive to some test bacteria, exhibiting mild activity against E. coli (10 mm), poor activity against S. typhi (8 mm), S. aureus (7 mm), and B.megaterium (7 mm). Another fungal strain Colletotrichum sp. (SCLE-9) showed poor activity against S. aureus (7 mm). On the other hand, all the test bacteria were found resistant to the strain Diaporthe sp. (SCBE-1), Colletotrichum sp. (SCBE-2) (SCBE-7), and Phyllosistica sp. (SCLE-7). Overall, leaves of Penicillium sp. showed significant antimicrobial activity than others fungal extracts. The result of the antimicrobial screening has been presented in the following Table 3.

Extracts from the plant (bark and leaf extract) and fungal strains of SCBE-3, SCBE-4, and SCLE-9 showed antimicrobial activity which indicates that they may produce secondary metabolites with antimicrobial potential.

3.5. Antioxidant Activity of Plant and Fungal Extracts

In the free radical scavenging assay, the extract of the leaf and bark part of the plant showed significant antioxidant activity with an IC₅₀ value of 2.93 and 4.42 μg/mL, respectively. Comparatively, the leaf extract of the plant exhibited better antioxidant activity than the bark extract. Among the endophytic fungi, Penicillium sp. (SCBE-4) showed the highest free radical scavenging activity which the IC₅₀ value (2.43 μg/mL) was near to that of ascorbic acid (2.42 μg/mL) and butylated hydroxy anisole (BHA) (2.14 μg/mL). It was also impressive that SCBE-4 showed more antioxidant activity than the leaf and bark parts of the plant. Another fungus Fusarium sp. (SCLE-8), Colletotrichum sp. (SCBE-7), and Phyllosistica sp. (SCLE-7) exhibited antioxidant activity with IC₅₀ values of 42.99, 47.77, and 51.23 μg/mL respectively. However, the IC₅₀ value was not possible to determine in case of the rest of the fungi because they have not exhibited 50% free radical scavenging activity (Figure 3).

3.6. Brine Shrimp Lethality Bioassay

In the brine shrimp lethality assay, the most potent activity was found from Fusarium sp. SCLE-8 (LC₅₀ 0.4467 μg/mL) and least activity from Phyllosistica sp. SCLE-7 (LC₅₀ 4.3481 μg/mL). Other strain of Colletotrichum sp. (SCLE-9), Pestalotiopsis sp. (SCBE-3), and Colletotrichum sp. (SCBE-7) exhibited a LC₅₀ value of 1.2259, 1.4848, and 1.8776 μg/mL, respectively. However, LC₅₀ could not be determined in case of leaf, bark, Diaporthe sp., Colletotrichum (SCBE-2), and Penicillium sp because their extract did not show 50% mortality in any concentration (Figure 4). So overall, the results suggest that extracts of Fusarium sp. (SCLE-8), Colletotrichum sp. (SCLE-9), Pestalotiopsis sp. (SCBE-3), and Colletotrichum sp. (SCBE-7) may contain secondary metabolites having antitumor activities.

4. Discussion

The need for discovering new chemical enteritis to treat different ailments is ever increasing as the world is continually facing new threats like cancer, AIDS, COVID-19 etc. Furthermore, the development of resistance of antibiotics and anticancer drugs is a global concern. From the ancient time, plants have served as a source of potential bioactive compounds against different ailments. Recently, endophytes associated with plants earned much attention from the researchers as they are offering metabolites with higher therapeutic potential than plants themselves [27]. Endophytic fungi are amazing organisms colonizing inside the plant tissue and are established as reservoirs of excellent bioactive metabolites [28]. Thus, the screening of bioactivities of natural products, either medicinal plants or fungi, with the aim to discover potential lead molecules can be underestimated.

Isolation of eight endophytic fungi from this plant was reported here, namely, Colletotrichum sp. (SCBE-2, SCBE-7, SCLE-9) while the rest of the isolates were belongs Diaporthe sp. (SCBE-1), Pestalotiopsis sp. (SCBE-3), Penicillium sp. (SCBE-4), Phyllosistica sp. (SCLE-7), and Fusarium sp. (SCLE-8). Diaporthe species is known as a major plant pathogen causing infections [29]. However, it has been reported to exert potential bioactivity [30]. Colletotrichum sp. is a widely distributed fungal genus reported as plant pathogens, but these fungi have been reported to produce secondary metabolites with diverse bioactivities [31]. Besides these, Colletotrichum sp. has been reported as a novel endophytic fungus which is able to produce taxol with excellent cytotoxic activity [32, 33]. Penicillium herquei, an endophytic fungus isolated from Cordyceps sinensis, produced three new α-pyrone derivatives [34]. Pestalotiopsis microspora isolated from Terminalia morobensis was enriched to the antioxidant compounds pestacin and isopestacin [11, 35]. Phyllosticta capitalensis is an endophyte and weak plant pathogen with a worldwide distribution presently known from 70 plant families [36]. Fusarium wilt is one of the major diseases caused by Fusarium oxysporum pathogenic strains. Some F. oxysporum strains are actually beneficial to the host and can provide protection against root pathogens [37]. Therefore, the goal of this study was to look into the endophytic fungi of Syzygium cumini as a source of bioactive compounds with cytotoxic, antioxidant, and antimicrobial properties. Preliminary screening of fungal extracts of isolated fungi reveals the presence of flavonoids, coumarin, isocoumarin, steroids, and many other bioactive phytochemicals.

Extracts of the endophytic fungal isolates and bark and leave extracts were subjected to screen for preliminary antimicrobial study by the disc diffusion method, cytotoxicity using the brine shrimp lethality bioassay, and antioxidant activity by DPPH free radical scavenging activity.

Overall extracts of leaf and Pestalotiopsis sp. and Penicillium sp. strain showed significant antimicrobial activity against tested human pathogenic bacteria S. typhi, B. megaterium, E. coli, and S. aureus. Only extracts of bark and leaves showed antifungal activity. The bioactivity screening of fungal crude extracts reveals the presence of strong and specific antimicrobial activity against different bacteria and fungi. Specific bioactivity may be defined as high inhibition of the growth of one type of target organism with little or no activity against others. This phenomenon suggests the presence of compounds that have specific modes of action as opposed to highly toxic compounds that are often of little use as therapeutics, which is interesting in drug discovery [38].

In the free radical scavenging assay, comparatively, the leaf extract of the plant exhibited better antioxidant activity than the bark extract. Among the isolated endophytic fungi, Penicillium sp. showed the highest free radical scavenging activity (IC₅₀ of 2.43 μg/mL, near to the IC₅₀ value of ascorbic acid 2.42 μg/mL) than any other fungal and plant extracts. So, it may be stated that Penicllium sp. may be a prominent source of the novel antimicrobial and antioxidant compound. In the brine shrimp lethality assay, the most potent activity was found from Fusarium sp. (LC₅₀ of 0.4467 μg/mL) and the least activity from Phyllosistica sp. (LC₅₀ of 4.3481 μg/mL). These results are consistent with other reports [35, 39–42].

Furthermore, phytochemical screening of the leaf, bark, and fungal extracts reveals the presence of several bioactive metabolites like flavonoids, terpenoids, steroids, coumrins, isocoumarins, anthraquinone, etc. Those classes of phytochemicals are found to exert several pharmacological activities like antibacterial, cytotoxic, antioxidant activity, etc. This finding is in line with the findings of previous researchers who found a variety of bioactive compounds in endophytic fungal extracts and medicinal plants [43–45].

5. Conclusions

This study is an attempt to isolate the endophytic fungus from the Syzygium cumini plant and explore the pharmacological activities of those fungi along with the plant part. This study showed that this plant is a plethora of endophytes that are capable of exerting many antioxidants and antimicrobial as well as cytotoxic activities. Plant parts are also bioactive. Thus, this approach may be a way of acquiring novel metabolites having a diverse range of biological activities. However, these endophytic fungi may contain biologically active compounds. Further research can be conducted to isolate the compound and investigate its pharmacological activities.

Data Availability

The data used to support the findings of this study are available from the corresponding author upon request.

Conflicts of Interest

The authors declare that they have no conflicts of interest regarding the publication.

Acknowledgments

The authors have received no external funding.

References

T. Yenn and D. Ibrahim, “Endophytic fungi from Syzygium cumini (L.) skeels leaves and its potential as antimicrobial agents,” in Proceedings of the IOP Conference Series: Earth and Environmental Science, IOP Publishing, Bristol, UK, 2019.
View at: Google Scholar
G. Strobel, B. Daisy, U. Castillo, and J. Harper, “Natural products from endophytic microorganisms,” Journal of Natural Products, vol. 67, no. 2, pp. 257–268, 2004.
View at: Publisher Site | Google Scholar
S. Mustafa, O. Betul, B. Celal, and S. Zeliha, “Bioactivity of EtOH and MeOH extracts of basidiomycetes mushroom stereum hirsutum on atherosclerosis,” Archives of Razi Institute, vol. 75, no. 3, pp. 2–8, 2021.
View at: Google Scholar
M. Sevindik, H. Akgul, Z. Selamoglu, and N. Braidy, “Antioxidant and antigenotoxic potential of infundibulicybe geotropa mushroom collected from north western Turkey,” Oxidative Medicine and Cellular Longevity, vol. 2020, no. 3, Article ID 5620484, 8 pages, 2020.
View at: Publisher Site | Google Scholar
M. Sevindik, B. Özdemir, N. Braidy, H. Akgül, I. Akata, and Z. Selamoglu, “Potential cardiogenic effects of poisonous mushrooms,” The Journal of Fungus, vol. 12, no. 1, pp. 80–86, 2021.
View at: Google Scholar
C. Bal, H. Baba, I. Akata, M. Sevindik, Z. Selamoğlu, and H. Akgül, “Biological activities of wild poisonous mushroom entoloma sinuatum (boletales),” KSU Journal of Agriculture and Nature, vol. 25, no. 1, pp. 83–87, 2022.
View at: Google Scholar
U. N. Treasure, A. C. Christiana, E. P. Maduabuchi et al., “The isolation, identification and antimicrobial activities of endophytic fungi from Azadirachta indica,” GSC Biological and Pharmaceutical Sciences, vol. 11, no. 3, pp. 115–124, 2020.
View at: Publisher Site | Google Scholar
P. Jain and P. Sharma, “Probiotics and their efficacy in improving oral health: a review,” Journal of Applied Pharmaceutical Science, vol. 2, pp. 151–163, 2012.
View at: Google Scholar
D. Wilson, “Endophyte: the evolution of a term, and clarification of its use and definition,” Oikos, vol. 73, no. 2, pp. 274–276, 1995.
View at: Publisher Site | Google Scholar
R. Tolulope, A. Adeyemi, M. Erute, and T. Abiodun, “Isolation and screening of endophytic fungi from three plants used in traditional medicine in Nigeria for antimicrobial activity,” International Journal of Green Pharmacy, vol. 9, no. 1, p. 58, 2015.
View at: Publisher Site | Google Scholar
G. Strobel and B. Daisy, “Bioprospecting for microbial endophytes and their natural products,” Microbiology and Molecular Biology Reviews, vol. 67, no. 4, pp. 491–502, 2003.
View at: Publisher Site | Google Scholar
J. Berdy, “Bioactive microbial metabolites,” Journal of Antibiotics, vol. 58, pp. 1–26, 2005.
View at: Publisher Site | Google Scholar
V. T. Chagas, L. M. França, S. Malik, and A. M. D. A. Paes, “Syzygium cumini (L.) skeels: a prominent source of bioactive molecules against cardiometabolic diseases,” Frontiers in Pharmacology, vol. 6, p. 259, 2015.
View at: Publisher Site | Google Scholar
M. Yadav, A. Yadav, and J. P. Yadav, “In vitro antioxidant activity and total phenolic content of endophytic fungi isolated from Eugenia jambolana lam,” Asian Pacific Journal of Tropical Medicine, vol. 7, pp. S256–S261, 2014.
View at: Publisher Site | Google Scholar
P. Jain and P. Sharma, “Antagonistic activity of endophytic fungi isolated from Syzygium cumini (L.) skeels,” International Journal of Library Science and Research, vol. 3, pp. 59–63, 2015.
View at: Google Scholar
S. Kusari, M. Lamshöft, S. Zühlke, and M. Spiteller, “An endophytic fungus from Hypericum perforatum that produces hypericin,” Journal of Natural Products, vol. 71, no. 2, pp. 159–162, 2008.
View at: Publisher Site | Google Scholar
N. S. Chowdhury, M. H. Sohrab, S. R. Rony et al., “Identification and bioactive potential of endophytic fungi from Monochoria hastata (L.) solms. Bangladesh,” Journal of Botany, vol. 45, pp. 187–193, 2016.
View at: Google Scholar
D. S. Bhakuni, M. Dhar, M. Dhar, B. Dhawan, and B. Mehrotra, “Screening of Indian plants for biological activity: part II,” Indian Journal of Experimental Biology, vol. 6, 1969.
View at: Google Scholar
T. Sadananda, M. Govindappa, and Y. Ramachandra, “In vitro antioxidant activity of lectin from different endophytic fungi of Viscum album L,” British Journal of Pharmaceutical Research, vol. 4, no. 5, pp. 626–643, 2014.
View at: Publisher Site | Google Scholar
N. Devi and J. Prabakaran, “Bioactive metabolites from an endophytic fungus penicillium sp. isolated from Centella asiatica,” Current Research in Environmental & Applied Mycology, vol. 4, no. 1, pp. 34–43, 2014.
View at: Publisher Site | Google Scholar
J. A. Crouch, B. B. Clarke, and B. I. Hillman, “Phylogenetic relationships and fungicide sensitivities of Colletotrichum graminicola isolates from turfgrass in North America,” International Turfgrass Society Research Journal, vol. 10, pp. 186–195, 2005.
View at: Google Scholar
T. J. White, T. Bruns, S. Lee, and J. Taylor, “Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics,” PCR protocols: A Guide to Methods and Applications, vol. 18, pp. 315–322, 1990.
View at: Google Scholar
N. Alzoreky and K. Nakahara, “Antibacterial activity of extracts from some edible plants commonly consumed in Asia,” International Journal of Food Microbiology, vol. 80, no. 3, pp. 223–230, 2003.
View at: Publisher Site | Google Scholar
Ö. Saral, O. Yildiz, R. Aliyazicioğlu et al., “Apitherapy products enhance the recovery of CCL4-induced hepatic damages in rats,” Turkish Journal of Medical Sciences, vol. 46, pp. 194–202, 2016.
View at: Publisher Site | Google Scholar
D. Z. Rechenchoski, A. M. L. Dambrozio, A. C. P. Vivan et al., “Antimicrobial activity evaluation and comparison of methods of susceptibility for Klebsiella pneumoniae carbapenemase (KPC)-producing Enterobacter spp. isolates,” Brazilian Journal of Microbiology, vol. 48, no. 3, pp. 509–514, 2017.
View at: Publisher Site | Google Scholar
S. Hannana, F. Afroz, M. Begum et al., “Bioactive potential of endophytic fungi isolated from Phyllanthus niruri L.,” Bangladesh Journal of Scientific & Industrial Research, vol. 55, no. 4, pp. 311–318, 2020.
View at: Publisher Site | Google Scholar
G. Sushanto, D. Gitishree, K. S. Sandeep, S. Han-Seung, and P. J. Kumar, “Endophytes: a treasure house of bioactive compounds of medicinal importance,” Frontiers in Microbiology, vol. 7, pp. 2–8, 2016.
View at: Google Scholar
P. Tiwari and H. Bae, “Endophytic fungi: key insights, emerging prospects, and challenges in natural product drug discovery,” Microorganisms, vol. 10, no. 2, p. 360, 2022.
View at: Publisher Site | Google Scholar
V. Guarnaccia, J. Z. Groenewald, J. Woodhall et al., “Diaporthe diversity and pathogenicity revealed from a broad survey of grapevine diseases in Europe,” Persoonia: Molecular Phylogeny and Evolution of Fungi, vol. 40, no. 1, pp. 135–153, 2018.
View at: Publisher Site | Google Scholar
T. C. Xu, Y. H. Lu, J. F. Wang et al., “Bioactive secondary metabolites of the genus diaporthe and anamorph phomopsis from terrestrial and marine habitats and endophytes: 2010–2019,” Microorganisms, vol. 9, no. 2, p. 217, 2021.
View at: Publisher Site | Google Scholar
J. W. Kim and S. H. Shim, “The fungus colletotrichum as a source for bioactive secondary metabolites,” Archives of Pharmacal Research, vol. 42, no. 9, pp. 735–753, 2019.
View at: Publisher Site | Google Scholar
J.-L. Rios, M. C. Recio, and A. Villar, “Screening methods for natural products with antimicrobial activity: a review of the literature,” Journal of Ethnopharmacology, vol. 23, no. 2-3, pp. 127–149, 1988.
View at: Publisher Site | Google Scholar
J. Zhao, C. Li, W. Wang et al., “Hypocrea lixii, novel endophytic fungi producing anticancer agent cajanol, isolated from pigeon pea (C. ajanus cajan (L.) M. illsp.),” Journal of Applied Microbiology, vol. 115, no. 1, pp. 102–113, 2013.
View at: Publisher Site | Google Scholar
D.-L. Guo, L. Qiu, D. Feng et al., “Three new α-pyrone derivatives induced by chemical epigenetic manipulation of Penicillium herquei, an endophytic fungus isolated from Cordyceps sinensis,” Natural Product Research, vol. 34, no. 7, pp. 958–964, 2020.
View at: Publisher Site | Google Scholar
J. K. Harper, A. M. Arif, E. J. Ford et al., “Pestacin: a 1,3-dihydro isobenzofuran from Pestalotiopsis microspora possessing antioxidant and antimycotic activities,” Tetrahedron, vol. 59, no. 14, pp. 2471–2476, 2003.
View at: Publisher Site | Google Scholar
S. Wikee, L. Lombard, P. W. Crous et al., “Phyllosticta capitalensis, a widespread endophyte of plants,” Fungal Diversity, vol. 60, no. 1, pp. 91–105, 2013.
View at: Publisher Site | Google Scholar
F. J. de Lamo and F. L. W. Takken, “Biocontrol by Fusarium oxysporum using endophyte-mediated resistance,” Frontiers of Plant Science, vol. 11, p. 37, 2020.
View at: Publisher Site | Google Scholar
G. J. Kaczorowski, M. L. Garcia, J. Bode, S. D. Hess, and U. A. Patel, “The importance of being profiled: improving drug candidate safety and efficacy using ion channel profiling,” Frontiers in Pharmacology, vol. 2, no. 78, pp. 78–11, 2011.
View at: Publisher Site | Google Scholar
J. Zhao, W. Sun, T. Shan et al., “Antimicrobial metabolites from the endophytic fungus Gliomastix murorum Ppf8 associated with the medicinal plant paris polyphylla var. yunnanensis,” Journal of Medicinal Plants Research, vol. 6, pp. 2100–2104, 2012.
View at: Google Scholar
X. Liu, M. Dong, X. Chen, M. Jiang, X. Lv, and G. Yan, “Antioxidant activity and phenolics of an endophytic Xylaria sp. from Ginkgo biloba,” Food Chemistry, vol. 105, no. 2, pp. 548–554, 2007.
View at: Publisher Site | Google Scholar
Y. C. Song, W. Y. Huang, C. Sun, F. W. Wang, and R. X. Tan, “Characterization of graphislactone A as the antioxidant and free radical-scavenging substance from the culture of Cephalosporium sp. IFB-E001, an endophytic fungus in Trachelospermum jasminoides,” Biological and Pharmaceutical Bulletin, vol. 28, no. 3, pp. 506–509, 2005.
View at: Publisher Site | Google Scholar
L.-W. Wang, B.-G. Xu, J.-Y. Wang et al., “Bioactive metabolites from Phoma species, an endophytic fungus from the Chinese medicinal plant Arisaema erubescens,” Applied Microbiology and Biotechnology, vol. 93, no. 3, pp. 1231–1239, 2012.
View at: Publisher Site | Google Scholar
N. S. Chowdhury, M. H. Sohrab, M. S. Rana, C. M. Hasan, S. Jamshidi, and K. M. Rahman, “Cytotoxic naphthoquinone and azaanthraquinone derivatives from an endophytic Fusarium solani,” Journal of Natural Products, vol. 80, no. 4, pp. 1173–1177, 2017.
View at: Publisher Site | Google Scholar
N. Khan, F. Afroz, M. N. Begum et al., “Endophytic fusarium solani: a rich source of cytotoxic and antimicrobial napthaquinone and aza-anthraquinone derivatives,” Toxicology Reports, vol. 5, pp. 970–976, 2018.
View at: Publisher Site | Google Scholar
D. Tungmunnithum, A. Thongboonyou, A. Pholboon, and A. Yangsabai, “Flavonoids and other phenolic compounds from medicinal plants for pharmaceutical and medical aspects: an overview,” Medicine (Baltimore), vol. 5, no. 3, p. 93, 2018.
View at: Publisher Site | Google Scholar

Copyright

Copyright © 2022 Mst. Mabiya Sultana Samapti et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

PDF Download Citation

Download other formats

Order printed copies

Views

603

Downloads

485

Citations