Research Article
Substitution of Soy Protein for Casein Prevents Oxidative Modification and Inflammatory Response Induced in Rats Fed High Fructose Diet
Table 2
List of genes and primer sequences.
| Gene | ID | NCBI reference sequence | Official symbol | Forward primer sequence (5′-3′) | Reverse primer sequence (5′-3′) |
| Glyceraldehyde-3-phosphate dehydrogenase | 24383 | NC_005103.3 | GAPDH | aaggggaacccttgatatgg | cggagatgatgacccttttg | Tumor necrosis factor | 24835 | NC_005119.3 | TNF- | gctgaggttggacggataaa | aaaatcctgccctgtcacac | Interleukin 6 | 24499 | NC_005103.3 | IL6 | caaaagagagcctgggactg | ggctgaagaattgctggaag | Plasminogen-activator inhibitor type 1 | 24617 | NC_005111.3 | PAI-I | gatctcctgggatcactcca | ttgggggatgtctacatggt | Adiponectin | 246253 | NC_005110.3 | Adipoq | gacaaggccgttctcttcac | gtccccttccccatacactt |
|
|