Table 1: Overview on tRF sequence reads in the H. volcanii cDNA library.

tRNA-derived fragment
tRNAtRNA #BeginEndSequence (5′–3′)LengthReadsReads/million

Class IValGAC192,328,2162,328,241GGGUUGGUGGUCUAGUCUGGUUAUGA26 nt1,149,00059,548
ValGAC202,328,3362,328,361
CysGCA131,603,3831,603,402GCCAAGGUGGCAGAGUUCGG20 nt95,2144,935
SerGCT292,620,3712,620,352GUUGCGGUAGCCAAGCCUGG20 nt44,2202,292
LeuCAG302,617,9162,617,897GCAGGGAUAGCCAAGUCUGG20 nt42,0062,177
ArgGCG43452,423452,401GUCCUGAUAGGGUAGUGGACUAU23 nt5,144267
AlaGGC101,048,5591,048,581GGGCUCGUAGAUCAGGGGUAGAU23 nt4,332225
LeuGAG312,564,8582,564,839GCGUGGGUAGCCAAGCCAGG20 nt3,606187
ValCAC332,264,0752,264,050GGGUUGGUGGUCUAGCCAGGUUAUGA26 nt3,576185
GlyCCC351,733,3861,733,366GCGCCGAUGGUCCAGUGGUAG21 nt915

Class IIAspGTC48311,827311,755GCCCGGGUGGUGUAGUGGCCCAUCAUACGA30 nt2,094109
AspGTC49311,725311,69630 nt1,962102

Class IIILeuCAA262,693,5222,693,553AUCCGCUCCCGUAGGGGUCCGUGGGUUCAAAU32 nt1,42574

Class IVSerGGA47408,423408,380GCCAGGAUGGCCGAGCGGUAAGGCGCACGCCUGGAAAGCGUGUU44 nt29115

The tRNA genes for which tRFs have been detected are shown. Columns “begin” and “end” list the position of the respective tRF on the H. volcanii chromosome. Sequence, length, and read numbers for each tRF are depicted. The presence of all tRFs could be verified by northern blot analyses (Figure 2 and data not shown), with the exception of ValCAC, GlyCCC, and SerGGA.