Differential Effect of Isooctane Doses on HaCaT and HeLa: A Multimodal Analysis

Table 2

Primer sequences and cycling conditions for real time PCR.

Genes	Expression primers and cycling conditions	Product size
18s rRNA	FP: GTAACCCGTTGAACCCCATT; RP: CCATCCAATCGGTAGTAGCG; Cycling: 95°C for 5 minutes (1 cycle), 95°C for 30 sec, 55°C for 30 sec, 72°C for 30 sec (40 cycles)	151 bp
E-cadherin	FP: CGGGAATGCAGTTGAGGATC; RP: AGGATGGTGTAAGCGATGGC; Cycling: 95°C for 5 minutes (1 cycle), 95°C for 30 sec, 55°C for 30 sec, 72°C for 30 sec (40 cycles)	201 bp

FP: forward primer; RP: reverse primer; bp: base pair.