Research Article
Differential Effect of Isooctane Doses on HaCaT and HeLa: A Multimodal Analysis
Table 2
Primer sequences and cycling conditions for real time PCR.
| Genes | Expression primers and cycling conditions | Product size |
| 18s rRNA | FP: GTAACCCGTTGAACCCCATT RP: CCATCCAATCGGTAGTAGCG Cycling: 95°C for 5 minutes (1 cycle), 95°C for 30 sec, 55°C for 30 sec, 72°C for 30 sec (40 cycles) | 151 bp |
| E-cadherin | FP: CGGGAATGCAGTTGAGGATC RP: AGGATGGTGTAAGCGATGGC Cycling: 95°C for 5 minutes (1 cycle), 95°C for 30 sec, 55°C for 30 sec, 72°C for 30 sec (40 cycles) | 201 bp |
|
|
FP: forward primer; RP: reverse primer; bp: base pair.
|