Research Article
Differential Expression of Three Flavanone 3-Hydroxylase Genes in Grains and Coleoptiles of Wheat
Table 2
Names and sequences of the primers used in the experiments.
| Primer | Sequence (5′-3′) | Sequence source | Accession No. |
| Primers for genomic DNA | | | | F3H3LP | GCGACACAAGTGGACGAT | whe24e20 | BJ237068 | F3H2RP | GAACGTCGCGATCGACAG | barley F3H (Meldgaard, 1992) | X58138 | Primers for 3′ region | | | | F3HLP | CCTACTTCTCGTACCCGGTG | barley F3H (Meldgaard, 1992) | X58138 | F3H2LP | ATTCGTCGTCAACCTCGG | barley F3H (Meldgaard, 1992) | X58138 | Oligo (dT) with 3′ adapter | GGCCACGCGTCGACTAGTACTTTTTTTTTTTTTTTTT | | | 3′ adapter | GGCCACGCGTCGACTAGTAC | | | F3H-3UTRRP | TCTGTCAGACACATGCACACA | 3′ region obtained by 3′ RACE | | F3Hint1LP | ACTGTCTTGTAGCCGCTTCC | 1st intron of F3H-A1, B1 | | Primers for RT-PCR | | | | F3H5LP | CAAGAAGCAGGCCAAGGAC | 3rd exon of F3H-A1, B1, D1 | | F3HARP | CCAAACTCACGATAACTCCTTATTTAC | 3′ regions of F3H-A1 | | F3HBRP | GGAGAATAATCAATCCCACCA | 3′ regions of F3H-B1 | | F3HDRP | CTGCTACACACGTACGGATACC | 3′ regions of F3H-D1 | | Primers for inverse PCR and | | | | chromosomal location analysis | | | | F3H1stintAspLP | TGCTAGAATGGCGGTGGGT | 1st intron of F3H-A1 | | F3H1stintBspLP | GATGATGGTGGGGAACGGT | 1st intron of F3H-B1 | | F3Hint2LP | GCCATGCCACGTAAAATGAT | 1st intron of F3H-D1 | | F3HABDRP | CTTCACCGGGTACGAGAAGT | 2nd exon of F3H-A1, B1, D1 | | F3HBLP | GCAGGTATACACGCATTCATTT | 1st exon and intron of F3H-B1 | | F3H3RP | GTGGCTGGAGACGATGAAG | whe24e20 | BJ237068 | F3H4LP | CGATACAGCGAGCGACTCAT | 2nd exon of F3H-A1, B1, D1 | | F3H4RP | AGGAACGTCTCGTTGCTCAC | 1st exon of F3H-A1, B1, D1 | | F3H5RP | TTGTGGTTTTCTGGACGTTG | 5′ regions of F3H-A1, B1, D1 | | F3HABDLP | GACAAGCTCCGGTACGACAT | 1st exon of F3H-A1, B1, D1 | | Primers for Actin | | | | TaActinLP | GAGGGATACACGCTTCCTCA | wheat actin | AB181991 | TaActinRP | GAAAGTGCTAAGAGAGGCCAAA | wheat actin | AB181991 |
|
|