Table 2: Names and sequences of the primers used in the experiments.

PrimerSequence (5′-3′)Sequence sourceAccession No.

Primers for genomic DNA
 F3H3LPGCGACACAAGTGGACGATwhe24e20BJ237068
 F3H2RPGAACGTCGCGATCGACAGbarley F3H (Meldgaard, 1992)X58138
Primers for 3′ region
 F3HLPCCTACTTCTCGTACCCGGTGbarley F3H (Meldgaard, 1992)X58138
 F3H2LPATTCGTCGTCAACCTCGGbarley F3H (Meldgaard, 1992)X58138
 Oligo (dT) with 3′ adapterGGCCACGCGTCGACTAGTACTTTTTTTTTTTTTTTTT
 3′ adapterGGCCACGCGTCGACTAGTAC
 F3H-3UTRRPTCTGTCAGACACATGCACACA3′ region obtained by 3′ RACE
 F3Hint1LPACTGTCTTGTAGCCGCTTCC1st intron of F3H-A1, B1
Primers for RT-PCR
 F3H5LPCAAGAAGCAGGCCAAGGAC3rd exon of F3H-A1, B1, D1
 F3HARPCCAAACTCACGATAACTCCTTATTTAC3′ regions of F3H-A1
 F3HBRPGGAGAATAATCAATCCCACCA3′ regions of F3H-B1
 F3HDRPCTGCTACACACGTACGGATACC3′ regions of F3H-D1
Primers for inverse PCR and
chromosomal location analysis
 F3H1stintAspLPTGCTAGAATGGCGGTGGGT1st intron of F3H-A1
 F3H1stintBspLPGATGATGGTGGGGAACGGT1st intron of F3H-B1
 F3Hint2LPGCCATGCCACGTAAAATGAT1st intron of F3H-D1
 F3HABDRPCTTCACCGGGTACGAGAAGT2nd exon of F3H-A1, B1, D1
 F3HBLPGCAGGTATACACGCATTCATTT1st exon and intron of F3H-B1
 F3H3RPGTGGCTGGAGACGATGAAGwhe24e20BJ237068
 F3H4LPCGATACAGCGAGCGACTCAT2nd exon of F3H-A1, B1, D1
 F3H4RPAGGAACGTCTCGTTGCTCAC1st exon of F3H-A1, B1, D1
 F3H5RPTTGTGGTTTTCTGGACGTTG5′ regions of F3H-A1, B1, D1
 F3HABDLPGACAAGCTCCGGTACGACAT1st exon of F3H-A1, B1, D1
Primers for Actin
 TaActinLPGAGGGATACACGCTTCCTCAwheat actinAB181991
 TaActinRPGAAAGTGCTAAGAGAGGCCAAAwheat actinAB181991