Table 2: A list of SNP markers, designated ID, primers, and probes for KASP assays developed and validated in in this study.

MarkerFluorescent primerSequence

FAD2-1A_17D (MU-HO-1)FAM_primer TCTCACTGGTGTGTGGGTGATTGCTCACGAGTGTGGTCACCATGCCTTCAG
HEX_primer TCTCACTGGTGTGTGGGTGATTGCTCACGAGTGTGGTCACCATGCCTTCAA
Reverse primer CAAGTACCAATGGGTTGATGATGTTGTGGGTTTGACCCTTCACTCAACA

FAD2-1A_452
(MU-HO-2)
FAM_primer TTTGTCCCAAAACCAAAATCCAAAGTTGCATGGTTTTCCAAGTACTTAAACAACCCTCTAGGAA
HEX_primer TTTGTCCCAAAACCAAAATCCAAAGTTGCATGGTTTTCCAAGTACTTAAACAACCCTCTAGGA
Reverse primer GGGCTGTTTCTCTTCTCGTCACACTCACAATAGGGTGGCCTATGTATTTAGCCTTC

FAD2-1B_327 (MU-HO-3)FAM_primer CCTTCAGCAAGTACCCATGGGTTGATGATGTTATGGGTTTGACCGTTCACTCAGCACTTTTAGTCCC
HEX_primer CCTTCAGCAAGTACCCATGGGTTGATGATGTTATGGGTTTGACCGTTCACTCAGCACTTTTAGTCCG
Reverse primer TTATTTCTCATGGAAAAYAAGCCATCGCCGCCACCACTCCAACACGGGTTCCCTTGACCGTGATG

FAD2-1B_I143T (MU-HO-4)FAM_primer TGGGTTGATGATGTTATGGGTTTGACCGTTCACTCAGCACTTTTAGTCCSTTATTTCTCATGGAAAAT
HEX_primer TGGGTTGATGATGTTATGGGTTTGACCGTTCACTCAGCACTTTTAGTCCSTTATTTCTCATGGAAAAC
Reverse primer AAGCCATCGCCGCCACCACTCCAACACGGGTTCCCTTGACCGTGATGAAGTGTTTGTCC

FAD3A_Del
(MU-LL-1)
FAM_primer AATAAGAACTAAATTTAAAAGTGAAGTTGAAT
HEX_primer AATAAGAACTAAATTTAAAAGTGAAGTTGAAC
Reverse primer GCAAGTTGTTCAGAAAACGTTAAAACTCC

FAD3A_Splice
(MU-LL-2)
FAM_primer CTGGACTTTGTCACATACTTGCATCACCATGGTCATCATCAGAAACTGCCTTGGTATCGCGGCAAGG
HEX_primer CTGGACTTTGTCACATACTTGCATCACCATGGTCATCATCAGAAACTGCCTTGGTATCGCGGCAAGA
Reverse primer TAACAAAAATAAATAGAAAATAGTGAGTGAACACTTAAATGTTAGATACTACCTTCTTCTTCTTT

FAD3B_Splice (MU-LL-3)FAM_primer GAATCTTTATGCTTCCTGAGGCTGTTCTTGAACATGGCTCTTTTTTATGTGTCATTATCTTAG
HEX_primer GAATCTTTATGCTTCCTGAGGCTGTTCTTGAACATGGCTCTTTTTTATGTGTCATTATCTTAA
Reverse primer TTAACAGAGAAGATTTACAAGAATCTAGACAGCATGACAAGACTCATTAGATTCACTGT

FAD3C_G128E
(MU-LL-4)
FAM_primer CATGGAAGTTTTTCAAACAGTCCTTTGTTGAACAGCATTGTGGGCCACATCTTGCACTCTTCAATTCTTGTACCATACCATGG
HEX_primer CATGGAAGTTTTTCAAACAGTCCTTTGTTGAACAGCATTGTGGGCCACATCTTGCACTCTTCAATTCTTGTACCATACCATGA
Reverse primer ATGGTCGGTTCCTTTTAGCAACTTTTCATGTTCACTTTGTCCTTAAATTTTTTTTTATGTTTGTT

FAD3C_H304Y
(MU-LL-5)
FAM_primer TAGATCGCGACTATGGTTGGATCAACAACATTCACCATGACATTGGCACCCATGTTATCCATC
HEX_primer TAGATCGCGACTATGGTTGGATCAACAACATTCACCATGACATTGGCACCCATGTTATCCATT
Reverse primer ACCTTTTCCCTCAAATTCCACATTATCATTTAATCGAAGCGGTATTAATTCTCTATTTC

KTI_2
(MU-KTI-1)
FAM_primer AACAAAGATGCAATGGATGGTTGGTTTAGACTTG
HEX_primer AACAAAGATGCAATGGATGGTTGGTTTAGACTTT
Reverse primer AGAGNNNNNNNTTTCTGATGATGAATTCAATAACTAT

STS_2
(MU-STS-1)
FAM_primer GAATTGGAGTGTGTTGAGAAGGGTGCAAAGGTTAAGGTTAAGGGTGATGGGAGATTCCTT_
HEX_primer GAATTGGAGTGTGTTGAGAAGGGTGCAAAGGTTAAGGTTAAGGGTGATGGGAGATTCCTTGCTTACTCAAGTGAATCTCCAAAGAAGTTCCAAY
Reverse primer TGAATGGTTCTGATGTTGCTTTTGAGTGGCTCCCTGATGGAAAACTCACTCTCAACCTTGCTTGGATTGAAGAGAATGGCGGGGTT

RS2_W
(MU-RS2-1)
FAM_primer GGTATGGGTGCCTTTGTTAGGGACTTGAAGGAACAGTTTAGGAGCGTGGAGCAGGTGTATGTG_
HEX_primer GGTATGGGTGCCTTTGTTAGGGACTTGAAGGAACAGTTTAGGAGCGTGGAGCAGGTGTATGTGTGG
Reverse primer CACGCGCTTTGTGGGTATTGGGGTGGGGTCAGACCCAAGGTTCCGGGCATGCCCCAGGCTAAGGTT

RS2_397
(MU-RS2-2)
FAM_primer CTGGGGAAGCTCAGAGGAATAAAATTCATGAGCATATTCCGGTTTAAGGTGTGGTGGACCAC
HEX_primer CTGGGGAAGCTCAGAGGAATAAAATTCATGAGCATATTCCGGTTTAAGGTGTGGTGGACCAT
Reverse primer TCACTGGGTCGGTAGCAACGGACACGAACTGGAGCACGAGACACAGATGATGCTTCTCGACA

Lox-1
(MU-Lox-1)
FAM_primer CATGCGGCGATGGAGCCATTCGTCATAGCAACACACCGACATCTTAGCGTGCTTCACCCAATTTA_
HEX_primer CATGCGGCGATGGAGCCATTCGTCATAGCAACACACCGACATCTTAGCGTGCTTCACCCAATTTACAAGCTTCTGACTCCTCACTATCGTAACAACATGAACATCAACGCACTTGCCAGGCAATCTCTAATTAATGCTA
Reverse primer ATGGCATAATAGAGACAACCTTTTTGCCCTCAAAGTATTCTGTGGAGATGTCTTCGGCGGTTT

Lox-2
(MU-Lox-2)
FAM_primer CATCTATGATGTATGTTATGTCTCAATTTTATTTTATTTTTATTTTTTATTTTGTTCATAGGTTAAATACTCAT
HEX_primer CATCTATGATGTATGTTATGTCTCAATTTTATTTTATTTTTATTTTTTATTTTGTTCATAGGTTAAATACTCAA
Reverse primer GCGGTGATTGAGCCATTCATCATAGCAACAAACCGACACCTTAGTGCTCTTCACCCAATTTATAAGCTTC

Lox3_G_100 (MU-Lox-3)FAM_primer AGGGACAGTGGTGTTGATGCGCAAGAATGTGTTGGACGTGAATAGCGTAACCAGCGTTGGGG_
HEX_primer AGGGACAGTGGTGTTGATGCGCAAGAATGTGTTGGACGTGAATAGCGTAACCAGCGTTGGGGG
Reverse primer AATTATTGGTCAAGGTCTCGACTTAGTTGGCTCAACACTCGATACTCTTACTGCCTT

_: HEX_primer and _: FAM_primer.