Abstract
The Escherichia coli sRNA GcvB regulates several genes involved in transport of amino acids and peptides (sstT, oppA, dppA, and cycA). Two regions of GcvB from nt +124 to +161 and from nt +73 to +82 are complementary with essentially the same region of the cycA mRNA. Transcriptional fusions of cycA to lacZ showed the region of cycA mRNA that can pair with either region of GcvB is necessary for regulation by GcvB. However, mutations in either region of gcvB predicted to disrupt pairing between cycA mRNA and GcvB did not alter expression of a cycA-lacZ translational fusion. A genetic analysis identified nts in GcvB necessary for regulation of the cycA-lacZ fusion. The results show that either region of GcvB complementary to cycA mRNA can basepair with and independently repress cycA-lacZ and both regions need to be changed to cause a significant loss of repression.
1. Introduction
The E. coli gcvB gene encodes a sRNA of 206 nts [1]. Transcription of gcvB is activated by GcvA when cellular glycine is high and repressed by GcvA when glycine is limiting; repression by GcvA requires the accessory GcvR protein [1]. GcvB regulates cycA, encoding the glycine transport protein [2]. Thus, GcvB regulates its own synthesis by controlling the level of glycine transported into the cell. A ΔgcvB strain shows constitutive synthesis of OppA and DppA, the periplasmic binding protein components of the two major peptide transport systems, SstT, a serine transport system, and CycA, a glycine transport system [1–4]. The Salmonella enterica serovar Typhimurium GcvB also regulates OppA and DppA levels and several other genes involved in transport of polar and branched amino acids and general amino acid metabolism [5, 6].
Evidence suggests GcvB regulates its target mRNAs by an antisense mechanism, basepairing with the mRNAs to prevent translation initiation [3–6]. Although it is unclear how extensive pairing between a sRNA and a mRNA must be, research indicates one or two regions of 8-9 basepairs is sufficient for regulation [7]. In cases where basepairing interactions occur, the RNA chaperone Hfq is required, likely to alter RNA secondary structures or to bring together sRNAs and target mRNAs, increasing local RNA concentrations [8–11]. Hfq binds GcvB [11, 12], stabilizing the RNA [5, 13], and loss of Hfq results in the loss of repression of GcvB target mRNAs [2, 4, 5, 13]. For sRNAs studied in detail that regulate by an antisense mechanism, often a single basepair change in the sRNA or its target mRNA results in a loss of regulation by the sRNA (e.g., the sRNA SgrS and its target ptsG mRNA [14]). For GcvB, however, it is surprising that most changes predicted to disrupt pairing with regions of the target mRNAs have little or no effect on GcvB’s ability to regulate [2–4].
GcvB homologs contain two conserved sequences of 13 nts (Con-I) and 10 nts (Con-II) (Figure 1(a)) [1, 3, 5]. In addition, a G/T-rich domain that includes the Con-I sequence was shown to be essential for interaction with most GcvB target mRNAs in E. coli and S. enterica [4, 5, 13]. In S. enterica, the Con-II region also pairs with cycA mRNA, possibly inhibiting translation initiation [6]. Analysis of E. coli GcvB identified two regions from nt +73 to +82 and from nt +124 to +161 complementary to cycA mRNA (Figures 1(b) and 1(c)). The region from +73 to +82 overlaps Con-I and the G/T-rich domain, and the region from +124 to +161 overlaps Con-II (Figure 1(a)). In addition, transcriptional fusions of cycA to lacZ verified the region from −8 to −26 upstream of the AUG start codon, and complementary with both the +73 to +82 and +124 to +161 regions of GcvB is required for regulation of cycA (Figures 1(b) and 1(c)) [2]. However, changes in either region of GcvB independently did not alter regulation of cycA-lacZ [2]. We devised a genetic selection to identify any nts in GcvB required to regulate cycA-lacZ. In this study, we show the region of GcvB from +73 to +82 as well from nt +124 to +161 is important for regulation of a cycA-lacZ fusion. In addition, both regions can independently repress, suggesting GcvB regulates cycA-lacZ by a mechanism that uses redundancy within GcvB.
(a)
(b)
(c)
2. Materials and Methods
2.1. Bacterial Strains, Plasmids, and Phage
The E. coli strains, plasmids, and phage used are listed in Table 1 or are described in the text.
2.2. Media
The complex medium used was Luria-Bertani broth (LB) [19]. Agar was added at 1.5% (w/v) to make solid medium. The defined medium used was the salts of Vogel and Bonner [20] supplemented with 0.4% (w/v) glucose (GM). Ampicillin (Amp) was added at 50 μg mL−1. X-gal was added at 40 μg mL−1.
2.3. DNA Manipulation
Plasmid DNA was isolated using a QIAprep Spin Miniprep Kit (Qiagen, Santa Clara, CA). Vent DNA polymerase, Taq DNA polymerase, and restriction enzymes were from New England Biolabs, Inc. (Beverly, MA). T4 DNA ligase was from Roche Diagnostics (Indianapolis, IN). Reactions were as described by the manufacturers.
2.4. Enzyme Assay
β-Galactosidase assays were performed on mid-log phase cells (OD600~0.5) using the chloroform/SDS lysis procedure [19]. Results are the averages of two or more assays with each sample done in triplicate. Results were analyzed using the Student’s t-test.
2.5. Random and Site-Directed Mutagenesis of gcvB
Plasmid pGS634 carries the allele on an EcoRI-HindIII fragment [2]. Using pGS634 as template, error-prone PCR was used [21] to amplify DNA containing gcvB. The upstream primer (GcvB-For) was 5′-CTAGGCGGAATTCGCGGTGGTAATCGTTTAGACATGGC with an EcoRI site (underlined) and hybridizes 50 bps upstream of the gcvB transcription start site. The downstream primer (GcvB-Rev) was 5′-GGGGAAGCTTGAAAGAGATGGTCGAACTGG with a HindIII site (underlined) and hybridizes to pGS634 beginning 44 bps after the gcvB transcription stop site. The 423 bp amplified DNA fragment was digested with EcoRI + HindIII, cloned into EcoRI-HindIII digested and gel-purified vector pGS341 [17], replacing the WT gcvA gene, and transformed into the ΔgcvB strain GS1144 lysogenized with λcycA-lacZ. After 1 round of Amp counterselection [19], cells were plated on LB plates + Amp + X-gal. Killing nontransformed lysogens made identification of darker blue colonies efficient. Plasmid DNA was prepared from potential mutants (dark blue transformants) and the DNA sequenced at the Core Facility at the University of Iowa to verify mutations.
Site-directed mutagenesis of gcvB was performed using the PCR “megaprimer” procedure [22] with pGS594 () as template. Changes were verified by DNA sequence analysis and are predicted by the mfold program [23, 24] to leave the GcvB secondary structure intact.
2.6. Construction of the Allele and Allele + Additional Mutations
The allele with bp changes that make a strong transcription terminator at t1 and removes sequence distal to t1 was constructed using as template and upstream primer GcvB-For and downstream primer GcvB-t1↑ 5′-GGGGAAGCTTGAAAAAAAAGGTAGCCGAATTAGCGGCTACCATGGTCTGAATCGCAG with a HindIII site (underlined) and that hybridizes beginning at bp +135 in gcvB. The amplified DNA was digested with EcoRI + HindIII, cloned into EcoRI-HindIII digested and gel-purified vector pGS341, replacing the WT gcvA gene. Base changes were verified by DNA sequence analysis and the plasmid-designated pGS642 () (Figure 2(a)). Mutations in gcvB were then combined with the allele by PCR. Plasmids pGS596 (), pGS602 (), pGS629 (), pGS644 (), and pGS645 () were used as templates with upstream primer GcvB-For and downstream primer GcvB-t1↑. The amplified DNA fragments were cloned as described for the allele. Changes were verified by DNA sequence analysis. The plasmids were designated pGS647 (), pGS649 (), pGS653 (), pGS655 (), and pGS656 (), respectively (Figure 1).
(a)
(b)
2.7. Construction of the gcvBΔ+74 : 82 Allele and gcvBΔ+74 : 82 Allele + Additional Mutations
The allele with a deletion from bp +74 to +82 was constructed using the PCR “megaprimer” procedure [22]. The new plasmid was designated pGS680 () (Figures 1(a) and 1(c)). Base changes were verified by DNA sequence analysis. Mutations in gcvB in the +124 to +161 region were then combined with the allele by the PCR “megaprimer” procedure [22]. The new plasmids were designated pGS682 (), pGS683 (), pGS684 (), pGS697 (), pGS698 (), and pGS699 () (Figure 1).
2.8. Construction of λcycA−24GG-lacZ, λcycA−29G-lacZ, and λcycA−30T-lacZ Mutations
Plasmid pcycA-lacZ carries an E. coli cycA-lacZ translational fusion [2]. Using pcycA-lacZ as template, PCR “megaprimer” mutagenesis [22] was used to create changes in cycA-lacZ (Figures 1(b) and 1(c)). Base changes were verified by DNA sequence analysis at the DNA Core Facility of the University of Iowa. The intermediate plasmids were designated -lacZ, -lacZ, and -lacZ. A 5,788 bp EcoRI-MfeI fragment from each plasmid carrying the mutant cycA-lacZ fusions and lacYA genes was then ligated into the EcoRI site of phage λgt2 [18]. The new phage was designated -lacZ, -lacZ, and -lacZ. The phage were used to lysogenize appropriate E. coli host strains as described previously [25]. Each lysogen was tested to ensure that it carried a single copy of the λ chromosome by infection with λcI90c17 [26]. All lysogens were grown at 30°C since all fusion phages carry the λcI857 mutation, resulting in a temperature sensitive λcI repressor [18].
2.9. RNA Isolation and Northern Analysis
E. coli strains were grown in 5 mL of LB to mid-log phase. Total RNA was isolated using an RNeasy Mini Kit (Qiagen, Santa Clara, CA) and quantified using a NanoDrop ND-1000 Spectrophotometer. Northern analysis and quantification of RNA were performed as described [13].
3. Results
3.1. Nucleotides in GcvB Important for cycA-lacZ Repression
It was suggested that in S. enterica several regions in GcvB can independently block translation initiation of cycA mRNA [6]. To identify any sequence in E. coli GcvB required to regulate cycA-lacZ, we devised a genetic selection. Since two regions of GcvB from nt +73 to +82 and from +124 to +161 are complementary to cycA mRNA (Figures 1(b) and 1(c)), we biased the selection by disrupting the primary pairing interactions between GcvB and cycA mRNA. If both regions are able to pair with cycA mRNA, disrupting the primary region of interaction would increase the chances of identifying additional nts important for repression. Starting with pGS634 () as template error-prone PCR was used to mutagenize gcvB [21]. Transformation of a ΔgcvB strain with the mutagenized DNA allowed us to identify two mutants with increased cycA-lacZ expression (darker blue colonies on X-gal plates). Plasmid DNA prepared from the mutants was sequenced, and two changes in gcvB were identified, a -T- to -C- change at nt +79 and a -G- to -A- change at nt +80 (Figure 1(a), boxed nts). The new plasmids were designated pGS644 () and pGS645 ().
To determine the effects of the mutations on cycA-lacZ expression, the ΔgcvBλcycA-lacZ lysogen was transformed with the new plasmids and control plasmid and assayed for β-galactosidase. β-galactosidase levels were 2-fold higher in the ΔgcvB lysogen compared to WT and repression was restored in the ΔgcvB[] transformant (Figure 3(a), lanes 1, 2, and 3). In addition, as reported [2], the allele repressed cycA-lacZ as well as WT (Figure 3(a), lane 4). In the presence of the and alleles, β-galactosidase levels were about 2-fold higher than in the control strains (Figure 3(a), compare lanes 3 and 4 with lanes 5 and 6). Of interest, changes at +79 and +80 (although different nts than the +79C and +80A changes) had no effect on cycA-lacZ expression in the absence of the mutation [2], suggesting both regions must be altered to see a loss of GcvB repression.
(a)
(b)
To determine if each gcvB allele produced comparable levels of GcvB, a Northern analysis was performed. The results showed about the same levels of GcvB for each RNA sample tested except the allele, which had about 60% of the WT level (Figure 3(b)). However, the allele showed normal repression of cycA-lacZ (Figure 3(a), lane 4). Thus, loss of repression for the and alleles is not due to reduced levels of the mutant RNAs.
3.2. Sequence Preceding Terminator t1 Is Able to Repress cycA-lacZ
One possibility that could explain the above results is either region of GcvB complementary to the cycA mRNA is sufficient to cause repression and both regions must be changed to see an effect. Two experiments provide results that support this hypothesis. Two Rho-independent terminator sequences can be found in gcvB centered at bp +121 and +189/190, designated t1 and t2, respectively (Figure 1(a)) [1]. Although in vivo and in vitro evidence suggests some termination occurs at t1 [1], no short transcript was detected in either E. coli or S. enterica by Northern analysis [5, 13]. We constructed a gcvB allele where t1 is a better Rho-independent terminator () (Figure 2(a)). If either region of GcvB complementary to cycA mRNA can pair with the mRNA to cause repression, elimination of sequence distal to t1 should still result in repression of cycA-lacZ. To ensure any regulation observed is not due to read-through of the allele, all sequence following t1 was deleted (see Materials and Methods). A Northern Blot showed the allele produced only a short RNA of ~134 nts and at levels about 80% of the WT level (Figure 2(b)). Thus, any change in regulation of cycA-lacZ is likely due to the short RNA rather than a change in the synthesis or stability of the RNA. β-Galactosidase levels were 2.4-fold higher in the ΔgcvB lysogen compared to WT, and repression was restored in the ΔgcvB[] complemented strain (Figure 4, compare lanes 1, 2, and 3). The allele showed ~1.5-fold better repression of cycA-lacZ than the WT gcvB allele (Figure 4, lanes 3 and 4). Although the change was small, it is statistically significant (P value = 0.02 relative the transformant). The results suggest the region distal to terminator t1 is not necessary for GcvB repression of cycA-lacZ.
(a)
(b)
Next, we introduced the +79C and +80A changes, as well as several other changes that do not alter cycA-lacZ expression in the full length GcvB, into the allele. The +79C (brown), +80A (purple), +76AAA (green), and +79CCCA (blue) changes reduce complementarity of GcvB with cycA mRNA (Figure 1(c)) and resulted in reduced repression of cycA-lacZ when combined with the allele (Figure 4(a), compare lane 4 with lanes 5–8). The +71CCC change (black) increases complementarity between GcvB and cycA mRNA (Figure 1(c)) and resulted in 1.3-fold increased repression (Figure 4(a), compare lanes 4 and 9). Although the change is small, it is statistically significant (P value = 0.005 relative to the transformant). A Northern analysis showed about the same amounts of GcvB for each of the RNA samples tested (Figure 4(b)), suggesting altered regulation is not due to altered levels of the mutant RNAs. The results show the region from +70 to +90 is sufficient for GcvB regulation of cycA-lacZ, but changes in this region only result in altered regulation if the region distal to t1 is changed or deleted.
3.3. The gcvBt1↑ Allele Is Dependent on Hfq
It is possible that the truncated GcvB is able to regulate independently of Hfq. To test this possibility, we transformed the Δhfq strain with phfq3+, , and alleles and assayed for β-galactosidase activity. As shown previously [2], the ΔhfqλcycA-lacZ lysogen showed high levels of β-galactosidase activity and repression was restored in the Δhfq[phfq3+] complemented strain (Figure 4(a), lanes 10 and 11). Both the Δhfq[] and Δhfq[] transformants showed high levels of β-galactosidase activity, suggesting the truncated GcvB still requires Hfq for repression of cycA-lacZ (Figure 4(a), lanes 12 and 13). The results indicate that the Hfq-binding site for GcvB occurs in the region preceding terminator t1.
3.4. Sequence Distal to Terminator t1 Is Able to Repress cycA-lacZ
To determine if the region distal to terminator t1 is able to repress cycA-lacZ, we constructed the allele. This mutation removes the region of GcvB that precedes terminator t1 (Figure 1(c)) and shown above to play a role in regulation of cycA-lacZ in the presence of the allele (Figure 4(a)). Despite the size of the deletion, the mfold program [23, 24] predicts the remaining secondary structure of GcvB to remain intact. The allele showed 1.8-fold better repression of cycA-lacZ than WT (Figure 5(a), compare lanes 1 and 4). Next, we introduced the +131CC, +142CA and +159CC changes that do not alter cycA-lacZ expression in the full length GcvB [2], as well as combinations of these changes, into the allele. The and mutations resulted in >2-fold higher levels of expression than the mutation (Figure 5(a), compare lane 4 with 5 and 10). The remaining mutations showed smaller but statistically significant increases in expression compared to the allele (Figure 5(a), compare lane 4 with lanes 6–9; P values of 0.036, 0.027, 0.004, and 0.014, resp.). A Northern analysis showed about the same levels of GcvB for each RNA sample tested (Figure 5(b)). The results suggest loss of repression or increased repression is not due to altered levels of the mutant RNAs.
(a)
(b)
We also combined the mutation with the allele. However, a Northern analysis of two separate RNA preparations from a strain carrying the allele showed only about 30% of the GcvB level found with . The results suggest the is unstable and was not pursued further.
3.5. Regulation Requires GcvB/CycA mRNA Interactions
To confirm altered regulation is due to altered GcvB/cycA mRNA interactions, we constructed a -lacZ fusion (an -AC- to -GG- change at nts −24, −25 relative to the cycA AUG start site); the changes reduce paring of cycA mRNA with both regions of GcvB complementary to cycA (Figures 1(b) and 1(c)). We also constructed -lacZ and -lacZ fusions (an -A- to -G- change at nt −29 and a -C- to -T- change at nt −30 relative to the cycA AUG start site, resp.); the changes reduce pairing of cycA mRNA with the +73 to +82 region of GcvB (Figures 1(b) and 1(c)). A -lacZ lysogen had ~5.5-fold lower levels of expression than the WTλcycA-lacZ lysogen, suggesting the -GG- change affects translation efficiency (Figure 6, compare lines 1 and 14). The -lacZ and -lacZ lysogens, as well as and complemented lysogens, showed essentially the same levels of expression, suggesting a complete loss of GcvB regulation (Figure 6, lines 14, 15, 16, and 18). However, the and alleles, that restore pairing with the allele, repressed -lacZ expression about 1.5-fold (Figure 6, compare line 14 with lines 17 and 19). Although the changes are less than the normal 2-fold repression observed for cycA by GcvB, the results are statistically significant (P values of 0.0001 and 0.0028 relative to the lysogen, resp.) and suggest pairing of GcvB in the +124 to +161 region with cycA mRNA is required for repression.
(a)
(b)
The WT -lacZ and -lacZ lysogens showed levels of expression similar to the WTλcycA-lacZ lysogen, suggesting the changes do not dramatically affect translation efficiency (Figure 6, compare lane 1 with lanes 4 and 9). In addition, β-galactosidase levels were about 2-fold higher in each ΔgcvB lysogen compared to its WT control and repression was restored in the ΔgcvB[] and ΔgcvB[] transformants (Figure 6, compare lanes 4–7 and lanes 9–12). This is not unexpected since the and changes disrupt pairing with GcvB in the +73 to +82 region but do not disrupt pairing in the +124 to +161 region (Figures 1(b) and 1(c)). However, the and alleles, that restore pairing with the and alleles, respectively, increased repression an additional 2-fold (Figure 6, compare lanes 4 and 8 and lanes 9 and 13). The results suggest pairing of GcvB in the +73 to +82 region with cycA mRNA is also required for repression. The above results are in agreement with a model of genetic redundancy as a mechanism for cycA regulation by E. coli GcvB.
4. Discussion
In E. coli and S. enterica, GcvB has been shown to regulate multiple genes involved in amino acid and peptide transport [1–6]. However, most changes in GcvB predicted to disrupt pairing with target mRNAs had no significant effect on GcvB-mediated repression [2–4]. For the cycA mRNA, GcvB shows 2 regions of complementarity (Figures 1(b) and 1(c)). In this study, we tested if either region of complementarity is able to independently repress cycA-lacZ. The allele produces a truncated GcvB of ~134 nts and would remove most of the region from nt +124 to +161 complementary with cycA mRNA (Figure 1(a)). The allele showed better repression of cycA-lacZ than WT gcvB (Figure 4, lanes 3 and 4). The results suggest the region distal to terminator t1 is not necessary for repression of cycA-lacZ and possibly prevents full repression by GcvB. Mutations in gcvB in the +76 to +82 region that reduce complementarity with cycA mRNA (Figure 1(c)) result in a significant loss of repression in the presence of the mutation (Figure 4, compare lane 4 with lanes 5–8), and a change at nts +71 to +73 that increases complementarity results in increased repression (Figure 4, compare lanes 4 and 9). These results suggest the region of complementarity preceding terminator t1 is responsible for repression in the background. Of interest, these mutations do not alter GcvB repression in the full-length molecule [2]. The allele, which removes the region of GcvB preceding terminator t1 involved in repression in the background (Figure 1(c)), also showed better repression of cycA-lacZ than WT gcvB (Figure 5(a), compare lanes 3 and 4). Thus, when the region of GcvB distal to terminator t1 is intact, the region of GcvB in the +74 to +82 region is not required for repression and appears to partially inhibit repression. Mutations in gcvB in the +131 to +160 region that do not alter GcvB repression in the full length GcvB [2] result in a significant loss of repression in the presence of the mutation (Figure 5(a), compare lane 4 with lanes 5–10). These results suggest the region of complementarity following terminator t1 is responsible for repression in the background. Several of the mutations change the Con-II sequence (Figure 1(b)). However, other changes that result in a loss of repression fall outside of this region. Thus, although the Con-II sequence is likely involved in regulation of cycA, additional sequence is also required. In many bacteria, multiple largely redundant sRNAs control identical target mRNAs [27, 28]. In addition, a single sRNA can regulate many genes [29, 30]. Although most sRNAs use one region for basepairing, a few use independent regions to basepair with different target mRNAs. For example, two regions of DsrA are necessary for full activity on the hns and rpoS mRNAs [31, 32] and two different regions of FnrS basepair with different sets of target mRNAs [33]. The results in this study show that 2 regions of GcvB complementary with the same region of the cycA mRNA are able to independently basepair with the cycA mRNA and repress expression by an antisense mechanism. In addition, the results open the possibility that GcvB can bind simultaneously and repress two different mRNA molecules.
Of interest, none of the mutations in the presence of the t1↑ allele or the Δ+74 : 82 allele resulted in a complete loss of GcvB repression of the cycA-lacZ fusion (Figures 4 and 5(a)). An examination of each mutant allele identified small regions that could still basepair with the cycA mRNA (not shown). If these small regions are involved in the repression observed, the results would suggest a high degree of flexibility in GcvB basepairing with target mRNAs. S. enterica GcvB also shows several redundant pairing regions with cycA, and in vitro experiments suggest several regions of GcvB independently inhibit translation initiation of cycA mRNA [6]. Thee results suggest genetic redundancy is a mechanism for regulation by GcvB.
Since many of the genes that respond to GcvB are involved in transport of small peptides and amino acids, we hypothesize this is a survival mechanism to turn down transporters under conditions that favor the presence of toxic molecules that are also transported by these systems [2]. Another class of genes regulated by GcvB is involved in acid resistance (unpublished results) [34], suggesting GcvB plays a role in E. coli survival at low pH. Both of these environmental stresses would be encountered as E. coli moves from an external environment into the GI tract. We hypothesize the functions of the genes regulated by GcvB are crucial to cell survival when cells colonize the GI tract and the redundancy in GcvB prevents accidental loss of regulation of these genes by mutation or possible changes in GcvB structure induced by environmental conditions.
Acknowledgments
This work was supported by Public Health Service Grant GM069506 from the National Institute of General Medical Sciences and the Vice President for Research, the Carver College of Medicine and the Department of Microbiology, University of Iowa.