Use of PCR-DGGE Based Molecular Methods to Analyse Microbial Community Diversity and Stability during the Thermophilic Stages of an ATAD Wastewater Sludge Treatment Process as an Aid to Performance Monitoring
Table 1
List of the oligonucleotide primers utilized in this study.
F: forward primer; R: reverse primer. The numbering denotes positions of primers relative to the E. coli 16S rDNA gene.
2GC clamp added to the 5′ end of the primer 338, 5′CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGG G 3′. Sequences represent the nucleotide sequences in the GC clamps of the respective primers.