International Scholarly Research Notices / 2013 / Article / Tab 3

Research Article

Analysis of CYP2D6 Allele Frequencies and Identification of Novel SNPs and Sequence Variations in Sardinians

Table 3

List of primers used in CYP2D6 sequencing Analysis. Forward and reverse primers were used to sequence both strands of PCR products.

Nucleotides positionForward primersReverse primers
Name5′-sequence-3′Name5′-sequence-3′

From −1780 to −1426P–1780GTCCTCCTGTCCTCAGTGGAT –1426C>TGTGTGCCACCACGTCTAGCTTTTT
From −1584 to −1287 –1584C>GCTGGACAACTTGGAAGAACCCYP2D6_02_RAGACGGAGATTTCCTCTTGTT
From −1584 to −1000–1000G>AACATCCTCCCGGGCTGCCTGAGGGT
From −1201 to −740CYP2D6_01_FGGTGCCTGTAGTCCCAGCTA –740C>TACAGACTCACACTGACACTTAG
From −750 to −327 –750_–749delGATGTGACTGGTGTGTGTGAGAGACYP2D6_03_RTGGGATAACCAGGGTTTCAG
From −320 to 1372D6–F [14]CCAGAAGGCTTTGCAGGCTTCA137_138insTGAAGTCCACATGCAGCA
From 19 to 48119G>ACTGGGGCTAGAAGCACTGCYP2D6_04_RCGTGATTTAAACGGCACTCA
From 479 to 883CYP2D6_02_FGCTGACACCAGAAGGAAAGG883G>CTCCCCGAAGCGGCGCCGCAA
From 843 to 1388843T>GACTAGGACCTGTAGTCTGGGGP2x2R [18]ACCGGATTCCAGCTGGGAAATG
From 1294 to 1707CYP2D6_03_FACCTGCACTAGGGAGGTGTG1707delTGCGGCCTCCTCGGTCACCC
From 1513 to 19791513C>TAGCTGGACAGAGCCAGGGACTG1979T>CGGACAGCCCGACTCCTCCTTC
From 1863 to 22911863_1864insTTTCGCCCCGACGCCCCTTTCGCCCC2291G>ACACTCGCCAAGTGCCAGCCTCCAC
From 2127 to 2616CYP2D6_04_FTTTGGGAAAGGACATTCCAG2615_2617delAAGGGCAGCCACTCTCACCT
From 2540 to 29882539_2542delAACTACAGCTGGATGAGCTGCT2988G>ACATGTGCCCCCGCCTGTACCCTT
From 2850 to 32882850C>TAGCTTCAATGATGAGAACCTG3288G>AGATGTCATATGGGTCACAC
From 3030 to 3494CYP2D6_07_FATGAACTTTGCTGGGACACC CYP2D6_05_RCCAGCCCTGCCTATACTCTG
From 3466 to 3853CYP2D6_05_FTAGTCCTCAATGCCACCACA3853G>AGAAGCGGAAGGGCTTCT
From 3790 to 41803790C>TCCACTCTCACCCTGCATCT4180G>CAGCTCATAGGGGGATGGG
From 4115 to 44014115C>TACCTCCCTGCTGCAGCACTT4401C>TTAACTGACATCTGCTCAGCCTCAAC
From 4265 to 4728CYP2D6_06_FTCCCTAGCCAGAGGCTCTAA2D6–R [14]ACTGAGCCCTGGGAGGTAGGTA

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.