International Scholarly Research Notices / 2013 / Article / Tab 1

Research Article

Activation of the NFκB Pathway Enhances AhR Expression in Intestinal Caco-2 Cells

Table 1

Sequences of primers used in qRT-PCR experiments.

PrimersSequence

β actin-F5′ CCCAGCACAATGAAGATCAA 3′
β actin-R5′ CGATCCACACGGAGTACTTG 3′
AhR-F5′ CAGAAAACAGTAAAGCCAATCC 3′
AhR-R5′ AATACAAAGCCATTCAGAGCC 3′
IL1β-F5′ AACAGGCTGCTCTGGGATT 3′
IL1β-R5′ TGGCTGCTTCAGACACTTGA 3′
IL8-F5′ AGACAGCAGAGCACACAAGC 3′
IL8-R5′ ATGGTTCCTTCCGGTGGT 3′
TNFα-F5′ CAGCCTCTTCTCCTTCCTGA 3′
TNFα-R5′ GCCAGAGGGCTGATTAGAGA 3′
TGFβ-F5′ CCGGATACTCAGGCCAGA 3′
TGFβ-R5′ AGAGATACGCAGGTGCAGGT 3′

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19.