Table 2: Primers used in quantitative PCR.

TargetPrimersSequence from 5′ to Annealing temperatureReference

Akkermansia muciniphila AM1CAGCACGTGAAGGTGGGGAC50°C [18]
AM2CCTTGCGGTTGGCTTCAGAT
Bifidobacterium genusBifido5′GAT TCT GGC TCA GGA TGA ACG C60°C[19, 20]
Bifido3′CTG ATA GGA CGC GAC CCC AT
Bifidobacterium adolescentis Ado-Ang5′GGA TCG GCT GGA GCT TGC TCC G63°C [21]
Ado3′CCC CGA AGG CTT GCT CCC AGT
Bifidobacterium bifidum Bifidum5′TGA CCG ACC TGC CCC ATG CT61°C [21]
Bifidum3′CCC ATC CCA CGC CGA TAG AAT
Bifidobacterium breve Breve5′AAT GCC GGA TGC TCC ATC ACA C62°C [21]
Breve3′GCC TTG CTC CCT AAC AAA AGA GG
Bifidobacterium catenulatum groupCaten5′GCC GGA TGC TCC GAC TCC T64°C [21]
Caten3′ACC CGA AGG CTT GCT CCC GAT
Bifidobacterium longum groupLongum5′TTC CAG TTG ATC GCA TGG TCT TCT65°C [21]
Longum3′GGC TAC CCG TCG AAG CCA CG
Clostridium coccoides groupg-Ccoc-FAAA TGA CGG TAC CTG ACT AA53°C [22]
g-Ccoc-RCTT TGA GTT TCA TTC TTG CGA A
Clostridium difficile Cdif-FTTG AGC GAT TTA CTT CGG TAA AGA62°C [23]
Cdif-RTGT ACT GGC TCA CCT TTG ATA TTY A
Clostridium leptum subgroupsg-Clept-FGCA CAA GCA GTG GAG T60°C [24]
sg-Clept-R3CTT CCT CCG TTT TGT ACC
Clostridium perfringens CPerf165FCGC ATA AYbG TTG AAA GAT GG64°C [25]
CPerf269RCCT TGG TAG GCC GTT ACC C
Staphylococcus aureus nuc geneNUC1GCG ATT GAT GGT GAT ACG GTT55°C [26]
NUC2AGC CAA GCC TTG ACG AAC TAA AGC

aR represents a (A/G) wobble nucleotide; Y represents a (C/T) wobble nucleotide.
bC in the reference was replaced by Y to detect better different C. perfringens strains.