The Identification and Differentiation between Burkholderia mallei and Burkholderia pseudomallei Using One Gene Pyrosequencing

Table 2

List of oligonucleotide primers used in pyrosequencing assays.

Organism	Target	Primer	Sequence (5′-3′)	Location (bp)^a
B. mallei	fliP	BmfliP-F1^b	ACGAACAGCGTGAGGAAGAG	2786291–2786310
	IS407A	BmIS407A-R1	CTAGAAGCCCATTGGCCCTAT	2786443–2786423
	Interface	Bm-S1	GGGGCAGGTCAACGA	2786417–2786403
	Interface	Bm-S3	GGCAGGTCAACGAGC	2786415–2786401
B. mallei	fliP	BmfliP-F2^b	CGAACAGCGTGAGGAAGAG	2786292–2786310
	IS407A	BmIS407A-R1	CTAGAAGCCCATTGGCCCTAT	2786443–2786423
	Interface	Bm-S3	GGCAGGTCAACGAGC	2786415–2786401
B. pseudomallei	fliP	BpfliP-F1	AGACGATGCTGCTGCTCAC	31112–31130
	fliP	BpfliP-R1^b	CCCGACGAGCACCTGATTC	31257–31239
	fliP	BpfliP-R2^b	GAACAGCGTGAGGAAGAGGG	31281–31262
	fliP	BpfliP-S4	GCTGTCGTTCCTGCC	31134–31148
B. pseudomallei	fliP	BpfliP-F2^b	GACGATGCTGCTGCTCAC	31113–31130
	fliP	BpfliP-R3	AACAGCGTGAGGAAGAGGG	31280–31262
	fliP	BpfliP-S5	AGCAGCGACAGCACG	31205–31191

Pyrosequencing primer sets for B. mallei and B. pseudomallei with respective target regions. Primers were designed using the design software supplied by the manufacturer.
^adenotes location on the published sequences of either B. mallei GenBank accession number NC_006348 or B. pseudomallei GenBank accession number NC_009076.
^bdenotes a biotinylated primer.
“Interface” denotes the sequence where IS407A interrupts the fliP gene.
“F” denotes forward primer used for PCR.
“R” denotes reverse primer used for PCR.
“S” denotes the pyrosequencing primers.
The primers were first rehydrated in molecular grade water to bring them to a 100 μM concentration for each primer. Forward and reverse primers were used at 1 μM concentration while the sequence primers were used at 100 μM.
The target sequence for the primer sets for B. mallei was: GCCTGCCGCAGCAGCGACAGCACGACGATGATCCGCGTGA, located at 2786360–2786399 bp in the sequence NCBI Genbank Accession #: NC_006348. The target sequence for the primer sets for B. pseudomallei was: GCGATGCTGCTGATGATGACGAGCTTCACGCGGATCATCA, located in the NCBI Genbank Accession #: NC_009076 at 31150–31189 bp. PCR primer targets for both B. mallei and B. pseudomallei are all located on their respective chromosome 1. All primer coordinates were last verified on April 1, 2014.