Research Article

Identification of pBC218/pBC210 Genes of Bacillus cereus G9241 in Five Florida Soils Using qPCR

Table 2

Oligonucleotide primers and probes used in qPCR assays.

ORF on pBC210 Protein or genePrimerSequence (5′→3′)LocationaAmplicon length (bp)Source

0047 Electron transport protein Rv193747FGGTGATTCGATCAGGTTCATTA54385–54406 140This study
47RCGCCATCCCGGTATTAAAG54506–54524
47PbTTTGAATCGACAGCAGCCTGCTGA54430–54453

0067cTranscriptional regulator67FCAATTGCCTTTAATACGTCACC82127–82148 135This study
67RCTCGTATGCGTTATGAAGACC82241–82261
67PbTGACGTTGCCGTATTTGACGACCGA82204–82228

0072dPolysaccharide polymerase72FACCCTAGTCCTTTCCCAAATA87419–87439 111This study
72RGCACAAACCAACAAGGAGA87511–87529
72PbTGCCAAGCTTCTTCCCTTCCAGAAAGA87472–87498

  16S rRNA16FGCGGTGGAGCATGTGGTT948–965 73This study
16RAGGGTTTTCAGAGGATGTCAAGAC997–1020
16PbAATTCGAAGCAACGCGAAGAACCTTACCA967–995

The location of oligonucleotide sequences was determined using the pBC210 plasmid sequence of B. cereus G9241 (GenBank accession number AAEK01000004.1) for ORF 0047, ORF 0067, and ORF 0072. For the internal amplification control, the B. cereus 16S rRNA sequence (GenBank accession number X55060) was used.
bFor direct PCR amplicon detection during the reaction, all probe oligonucleotides were labeled with a 6-FAM (6-carboxy-flourescein) reporter at the 5′ end and a Black Hole Quencher-1 quencher at the 3′ end.
cThe qPCR assay for ORF 0067 was used to confirm all positive tests determined by assays for ORF 0047 and ORF 0072 and was later performed on all of the bacterial and soil sample DNA.
dORF 0072 is previously notated as pBC218-ORF 0073 (Hoffmaster et al., 2006) [11], while GenBank currently designates it as ORF 0072.