Journal of Nucleic Acids / 2013 / Article / Tab 1

Research Article

Immobilization of DNA Aptamers on Polyester Cloth for Antigen Detection by Dot Blot Immunoenzymatic Assay (Aptablot)

Table 1

Oligonucleotide sequences used in this study.

AptamerSequence (5′-3′)Length (bp)Source

Apt 1GGTTGGTGTGGTTGG15[5]
Apt 2AGTCCGTGGTAGGGCAGGTTGGGGTGACT29[6]
Apt 3GCTCCTACAAATGCCATCATTAGTCCGTG 67This study
GTAGGGCAGGTTGGGGTGACTGCTGCAG
CGAGCTTACG
Apt 4AGATGCCTGTCGAGCATGCTCTTTGGAGA 105[6]
CAGTCCGTGGTAGGGCAGGTTGGGGTGA
CTTCGTGGAAGAAGCGAGACGGTGTAGC
TAAACTGCTTTGTCGACGGG
VT 1ACTGGATGATCTCAGTGGGCGTTCTTATG TAATGACTGCTGAA50[4]

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19.