Table 2: Sequences of RNA aptamers selected following membrane- and plate-SELEX.

Groupn 1Sequence2

mA43ATTAGCTATCTTCCACGATTCGATCAGGCAGTACGTCGT3,4
mB35ACAGTTATCCGACTGCTATTCGATCAGGCAGTACGTAGC3,5
mC6CAGGCTGTTCTGACGCATAAGGAATGCGCTGTTGCAGAG
mD4TTGGTCCTGCTTTGGATAGTCGCGAAAGGGGTGCCACTG
m-Singles8Orphan sequences6
pA29ACAGTTATCCGACTGCTATTCGATCAGGCAGTACGTAGC3,5
pB18ACCGAGCGGTTTTACGTCTCAAGTAGTATCCCGTTTTGC
pC7ATTAGCTATCTTCCACGATTCGATCAGGCAGTACGTCGT3,4
pD4TTGCCATCCTGTACTATGCTCTATCGGGCGGTTTAGTGATCCTTCGTCCAACTATC
p-Singles42Orphan sequences5

Number of isolates harboring the represented sequence in each group. 2Complete random sequences of the aptamer core regions (5′-3′) are shown. 3Underlined sequence of 19 bases is identical among groups mA, mB, pA and pC. 4Complete sequences of mA and pC groups are identical. 5Complete sequences of mB and pA groups are identical. 6Orphan sequences are the sequences that are seen only in one isolate.