Research Article
Molecular Characterization of Human Rotavirus from Children with Diarrhoeal Disease in Sokoto State, Nigeria
Table 2
Primers used for VP4 genotyping of human rotavirus.
| Primer designation | Sequence (5′-3′) | Nucleotide position | Genotype |
| Con2 | ATTTCGGACCATTTATAACC | 868–887 | — | Con3 | TGGCTTCGCTCATTTATAGACA | 11–32 | — | 1-TI-KU | ACTTGGATAACGTGC | 336–356 | P |
2T-1 | CTATTGTTAGAGGTTAGAGTC | 474–494 | P | 3T-1 | TGTTGATTAGTTGGATTCAA | 259–278 | P | 4T-1 | TGAGACATGCAATTGGAC | 385–402 | P | 5T-1 | ATCATAGTTAGTAGTCGG | 575–594 | P |
|
|
Source: Noguchi Memorial Institute for Medical Research (NMIMR).
|