Roles of Integrins and Intracellular Molecules in the Migration and Neuritogenesis of Fetal Cortical Neurons: MEK Regulates Only the Neuritogenesis

Table 3

Primers used for the amplification of integrin cDNA from rat fetal brain neurons.

Subunit	Sense primer (5′-3′)	Antisense primer (5′-3′)	Amplicon size
β1	aatgtttcagtgcagagcc	ttgggatgatgtcgggac	261
β3	agctgtcgctgtccttcaat	cctgctgagagggtcgatag	357
β4	gctctacacggacaccacct	tgcagcaggcacagtatttc	398
α1	tggatattggccctaagcag	cgcttgcgatcgattttatt	399
α2	tggggtgcaaacagacaagg	gtaggtctgctggttcagc	539
α3	ctgctgccaaaaaagccaagt	ggcagctcctccaccagct	300
α4	cccaggctacatcgttttgt	atggtcttcatgctcccaac	444
α5	aggtgacgggactcaacaac	agccgagcttgtagaggaca	489
α v	gagcagcaaggactttggg	gggtacacttcaaggccagc	619
α6	gactcttaactgtagcgtga	atctctcgctcttctttccg	550 (α6A), 420 (α6B)
α9	tcccccagtactcgatgaag	cagtctctcccagcaacaca	396