Table 6

GeneForward primerReverse primer

UCP1GAAGGATTGCCGAAACTGCAATGAACACTGCCACAC
THR- GTCAGACCCAGAGGAGAACAGCACAAGTGATACAGCGGTAGTG
THR- CAACCAGTGCCAGGAATGTCCGCCTCTTCTCACGGTTC
CRFR2CTGCTTCCAGTGCTCCAGGTGCTACTAGGGCTCCGGGTGC
AdiponectinCACCAAAAGGGCTCAGGATGCCTGCCATCACGGCCTGGTGTG
Adiponectin receptor 1GCACAGTGGGACCGGTTTGCCACCGTGGTGGCCTTGAC
Adiponectin receptor 2GTCAGAGCAGGAGTGTTCGTGGTGGCAGCCTTCAGGAAC
-SctinGCCTTCCTTCTTGGGTATGGATCTTGATCTTCATGGTGC