Tuberculosis Research and Treatment / 2014 / Article / Tab 1

Research Article

Extensive Genetic Diversity among Clinical Isolates of Mycobacterium tuberculosis in Central Province of Iran

Table 1

The primers sequences used.

Target genesPrimersAnnealing (°C)Amplicon size (bp)References

16S rRNAACGGTGGGTACTAGGTGTGGGTTTC62543 [7]
TCTGCGATTACTAGCGACTCCGACTTCA

IS6110 CCTGCGAGCGTAGGCGTCGG68123 [8]
CTCGTCCAGCGCCGC

RD1AAGCGGTTGCCGCCGACCGACC62146 [9]
CTGGCTATATTCCTGGGCCCGG
GAGGCGATCTGGCGGTTTGGGG

RD4ATGTGCGAGCTGAGCGATG62172 [9]
TGTACTATGCTGACCCATGCG
AAAGGAGCACCATCGTCCAC

RD9CAAGTTGCCGTTTCGAGCC62235 [9]
CAATGTTTGTTGCGCTGC
GCTACCCTCGACCAAGTGTT

RD12GGGAGCCCAGCATTTACCTC62369 [9]
GTGTTGCGGGAATTACTCGG
AGCAGGAGCGGTTGGATATTC