Table 2: Sequences of nucleotide primers used in the study.

Primer codeTarget genePrimer sequencePCR product size

M1FMAT1-1ATTGCCCATTTGGCCTTGAA396 base pairs
M1RMAT1-1TTGATGACCATGCCACCAGA396 base pairs
M2FMAT1-2GCATTCATCCTTTATCGTCAGC270 base pairs
M2RMAT1-2GCTTCTTTTCGGATGGCTTGCG270 base pairs