Research Article
Characterization of Mating Type Genes in Aspergillus flavus Populations from Two Locations in Kenya
Table 2
Sequences of nucleotide primers used in the study.
| Primer code | Target gene | Primer sequence | PCR product size |
| M1F | MAT1-1 | ATTGCCCATTTGGCCTTGAA | 396 base pairs | M1R | MAT1-1 | TTGATGACCATGCCACCAGA | 396 base pairs | M2F | MAT1-2 | GCATTCATCCTTTATCGTCAGC | 270 base pairs | M2R | MAT1-2 | GCTTCTTTTCGGATGGCTTGCG | 270 base pairs |
|
|