Advances in Hematology / 2012 / Article / Tab 2

Research Article

DNMT3A Mutations in Patients with Acute Myeloid Leukemia in South Brazil

Table 2

Primer sequences for genes of interest.

Chromosomal translocationFusion transcriptSequence (5′–3′)

t(8;21)AML1-ACTACCGCAGCCATGAAGAACC
ETO-BAGAGGAAGGCCCATTGCTGAA
PML-A1CAGTGTACGCCTTCTCCATCA
t(15;17)PML-A2CTGCTGGAGGCTGTGGAC
RAR -BGCTTGTAGATGCGGGGTAGA
inv16CBF -AGCAGGCAAGGTATATTTGAAGG
MYH11-B2TCCTCTTCTCCTCATTCTGCTC
t(9;11)MLL6SGCAAACAGAAAAAAGTGGCTCCCCG
AF9AS3TCACGATCTGCTGCAGAATGTGTCT
GeneExonSequence (5′–3′)
DNMT3A Exon 19CACCACTGTCCTATGCAGACA
ATTAGTGAGCTGGCCAAACC
DNMT3A Exon 20CCTTGGCTCATCTTCAAACC
CACTATGGGTCATCCCACCT
DNMT3A Exon 21CCGCTGTTATCCAGGTTTCT
CCCAGCAGAGGTTCTAGACG
DNMT3A Exon 22TTTGGTAGACGCATGACCAG
AGCACAGCAATCAGAACAGC
DNMT3A Exon 23TCCTGCTGTGTGGTTAGACG
ATGATGTCCAACCCTTTTCG

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.