Table of Contents Author Guidelines Submit a Manuscript

Citations to this Journal [2,258 citations: 101–200 of 2,147 articles]

Articles published in Advances in Hematology have been cited 2,258 times. The following is a list of the 2,147 articles that have cited the articles published in Advances in Hematology.

  • Junhua Lv, and Feng Liu, “The Role of Serotonin beyond the Central Nervous System during Embryogenesis,” Frontiers in Cellular Neuroscience, vol. 11, 2017. View at Publisher · View at Google Scholar
  • Junhua Lv, and Feng Liu, “The Role of Serotonin beyond the Central Nervous System during Embryogenesis,” Frontiers in Cellular Neuroscience, vol. 11, 2017. View at Publisher · View at Google Scholar
  • Jennifer W. Leiding, “Neutrophil Evolution and Their Diseases in Humans,” Frontiers in Immunology, vol. 8, 2017. View at Publisher · View at Google Scholar
  • Sakhila Ghimire, Daniela Weber, Emily Mavin, Xiao nong Wang, Anne Mary Dickinson, and Ernst Holler, “Pathophysiology of GvHD and Other HSCT-Related Major Complications,” Frontiers in Immunology, vol. 8, 2017. View at Publisher · View at Google Scholar
  • Arjang Baygan, Wictor Aronsson-Kurttila, Gianluca Moretti, Babylonia Tibert, Göran Dahllöf, Lena Klingspor, Britt Gustafsson, Bita Khoein, Guido Moll, Charlotta Hausmann, Britt-Marie Svahn, Magnus Westgren, Mats Remberger, Behnam Sadeghi, and Olle Ringden, “Safety and Side Effects of Using Placenta-Derived Decidual Stromal Cells for Graft-versus-Host Disease and Hemorrhagic Cystitis,” Frontiers in Immunology, vol. 8, 2017. View at Publisher · View at Google Scholar
  • Jean-Christophe Avarre, “Editorial: Molecular Tracing of Aquatic Viruses: Where Epidemiology Needs to Meet Genomics,” Frontiers in Microbiology, vol. 8, 2017. View at Publisher · View at Google Scholar
  • Rebecca Kohnken, Pierluigi Porcu, and Anjali Mishra, “Overview of the Use of Murine Models in Leukemia and Lymphoma Research,” Frontiers in Oncology, vol. 7, 2017. View at Publisher · View at Google Scholar
  • Wenyong Long, Yang Yi, Shen Chen, Qi Cao, Wei Zhao, and Qing Liu, “Potential New Therapies for Pediatric Diffuse Intrinsic Pontine Glioma,” Frontiers in Pharmacology, vol. 8, 2017. View at Publisher · View at Google Scholar
  • Ivyna Pau Ni Bong, Ching Ching Ng, Puteri Baharuddin, and Zubaidah Zakaria, “MicroRNA expression patterns and target prediction in multiple myeloma development and malignancy,” Genes & Genomics, vol. 39, no. 5, pp. 533–540, 2017. View at Publisher · View at Google Scholar
  • Nader Kim El-Mallawany, Mercy Mutai, Idah Mtete, Satish Gopal, Christopher C. Stanley, Peter Wasswa, Mary Mtunda, Mary Chasela, William Kamiyango, Jimmy Villiera, Yuri Fedoriw, Nathan D. Montgomery, George N. Liomba, Coxcilly Kampani, Robert Krysiak, Katherine D. Westmoreland, Maria H. Kim, Jeremy S. Slone, Michael E. Scheurer, Carl E. Allen, Parth S. Mehta, and Peter N. Kazembe, “Beyond Endemic Burkitt Lymphoma: Navigating Challenges of Differentiating Childhood Lymphoma Diagnoses Amid Limitations in Pathology Resources in Lilongwe, Malawi,” Global Pediatric Health, vol. 4, pp. 2333794X1771583, 2017. View at Publisher · View at Google Scholar
  • P. W. Collins, D. V. K. Quon, M. Makris, P. Chowdary, C. L. Kempton, S. J. Apte, M. V. Ramanan, C. R. M. Hay, B. Drobic, Y. Hua, T. J. Babinchak, and E. D. Gomperts, “Pharmacokinetics, safety and efficacy of a recombinant factor IX product, trenonacog alfa in previously treated haemophilia B patients,” Haemophilia, 2017. View at Publisher · View at Google Scholar
  • Joyce Neumann, “Nursing Challenges Caring for Bone Marrow Transplantation Patients with Graft Versus Host Disease,” Hematology/Oncology and Stem Cell Therapy, 2017. View at Publisher · View at Google Scholar
  • Said Yousuf Mohamed, “Thalassemia Major: Transfusion and Chelation or Transplantation,” Hematology/Oncology and Stem Cell Therapy, 2017. View at Publisher · View at Google Scholar
  • Kamal A. Kadhim, Kadhim H. Baldawi, and Faris H. Lami, “Prevalence, Incidence, Trend, and Complications of Thalassemia in Iraq,” Hemoglobin, pp. 1–5, 2017. View at Publisher · View at Google Scholar
  • D. Kurant, S.I. Fisher, W. Tang, and N.S. Aguilera, “B-lymphoblastic leukemia/lymphoma arising in treated plasma cell myeloma: A rare second malignancy,” Human Pathology: Case Reports, vol. 10, pp. 60–63, 2017. View at Publisher · View at Google Scholar
  • Biswanath Behera, Laxmisha Chandrashekar, Nachiappa Rajesh, Rashmi Kumari, Devinder Thappa, and Rakhee Kar, “Primary cutaneous plasmablastic lymphoma presenting as perineal ulcero-proliferative growth in a human immunodeficiency virus-seropositive patient,” Indian Journal of Dermatology, Venereology and Leprology, vol. 83, no. 1, pp. 83–86, 2017. View at Publisher · View at Google Scholar
  • Jina Bhattacharyya, Sukanta Nath, Kandarpa Kumar Saikia, Renu Saxena, Sudha Sazawal, Manash Pratim Barman, and Dushyant Kumar, “Prevalence and Clinical Significance of FLT3 and NPM1 Mutations in Acute Myeloid Leukaemia Patients of Assam, India,” Indian Journal of Hematology and Blood Transfusion, 2017. View at Publisher · View at Google Scholar
  • Olugbenga Akindele Silas, Chad J. Achenbach, Lifang Hou, Robert L. Murphy, Julie O. Egesie, Solomon A. Sagay, Oche O. Agbaji, Patricia E. Agaba, Jonah Musa, Agabus N. Manasseh, Ezra D. Jatau, Ayuba M. Dauda, Maxwell O. Akanbi, and Barnabas M. Mandong, “Outcome of HIV-associated lymphoma in a resource-limited setting of Jos, Nigeria,” Infectious Agents and Cancer, vol. 12, no. 1, 2017. View at Publisher · View at Google Scholar
  • Virginia Camacho, Victoria McClearn, Sweta Patel, and Robert S. Welner, “Regulation of normal and leukemic stem cells through cytokine signaling and the microenvironment,” International Journal of Hematology, vol. 105, no. 5, pp. 566–577, 2017. View at Publisher · View at Google Scholar
  • L. C. Rizo-de-la-Torre, B. Ibarra, J. Y. Sánchez-López, M. T. Magaña-Torres, V. M. Rentería-López, and F. J. Perea-Díaz, “ Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients ,” International Journal of Laboratory Hematology, 2017. View at Publisher · View at Google Scholar
  • Giona Sonego, Mélanie Abonnenc, Jean-Daniel Tissot, Michel Prudent, and Niels Lion, “Redox Proteomics and Platelet Activation: Understanding the Redox Proteome to Improve Platelet Quality for Transfusion,” International Journal of Molecular Sciences, vol. 18, no. 2, pp. 387, 2017. View at Publisher · View at Google Scholar
  • Yordan Sbirkov, Colin Kwok, Amandeep Bhamra, Andrew Thompson, Veronica Gil, Arthur Zelent, and Kevin Petrie, “Semi-Quantitative Mass Spectrometry in AML Cells Identifies New Non-Genomic Targets of the EZH2 Methyltransferase,” International Journal of Molecular Sciences, vol. 18, no. 7, pp. 1440, 2017. View at Publisher · View at Google Scholar
  • Gonzálo Ramírez-García, Silvia Gutiérrez-Granados, Marco A. Gallegos-Corona, Lourdes Palma-Tirado, Fanny d’Orlyé, Anne Varenne, Nathalie Mignet, Cyrille Richard, and Minerva Martínez-Alfaro, “Long-term toxicological effects of persistent luminescence nanoparticles after intravenous injection in mice,” International Journal of Pharmaceutics, 2017. View at Publisher · View at Google Scholar
  • Walla'a A. Osman, Dina A. Labib, Mona O. Abdelhalim, and Elsayed M. Elrokh, “Synergistic analgesic, anti-pyretic and anti-inflammatory effects of extra virgin olive oil and ibuprofen in different experimental models in albino mice,” International Journal of Rheumatic Diseases, 2017. View at Publisher · View at Google Scholar
  • Do Hyoung Lim, Ji-Young Rhee, and Keon Woo Park, “Stage IV advanced diffuse large B-cell lymphoma in human immunodeficiency virus infection with achieving cure by using highly active antiretroviral therapy alone: a case report,” International Journal of STD & AIDS, pp. 095646241668651, 2017. View at Publisher · View at Google Scholar
  • MiamiAbdul Hassan Ali, EamanMarouf Muhammad, BanHadi Hameed, and HalaHashim Hasoobe, “The impact of Helicobacter pylori infection on iron deficiency anemia in pregnancy,” Iraqi Journal of Hematology, vol. 6, no. 2, pp. 60, 2017. View at Publisher · View at Google Scholar
  • Elaine Dupuis, Misha Zarbafian, Jessica Asgarpour, Laurie Parsons, and P. Régine Mydlarski, “Plasmablasticlike lymphoma arising within chronic pyoderma gangrenosum,” JAAD Case Reports, vol. 3, no. 3, pp. 200–201, 2017. View at Publisher · View at Google Scholar
  • V. Lokesh Battula, Phuong M. Le, Jeffrey C. Sun, Khoa Nguyen, Bin Yuan, Ximin Zhou, Sonali Sonnylal, Teresa McQueen, Vivian Ruvolo, Keith A. Michel, Xiaoyang Ling, Rodrigo Jacamo, Elizabeth Shpall, Zhiqiang Wang, Arvind Rao, Gheath Al-Atrash, Marina Konopleva, R. Eric Davis, Melvyn A. Harrington, Catherine W. Cahill, Carlos Bueso-Ramos, and Michael Andreeff, “AML-induced osteogenic differentiation in mesenchymal stromal cells supports leukemia growth,” JCI Insight, vol. 2, no. 13, 2017. View at Publisher · View at Google Scholar
  • Angela Dauti, Brigitte Gerstl, Serena Chong, Orin Chisholm, and Antoinette Anazodo, “Improvements in Clinical Trials Information Will Improve the Reproductive Health and Fertility of Cancer Patients,” Journal of Adolescent and Young Adult Oncology, 2017. View at Publisher · View at Google Scholar
  • Kiser, White, Johnson, Hoff, Taylor, and Neibergs, “Identification of loci associated with susceptibility to mycobacterium avium subspecies paratuberculosis (Map) tissue infection in cattle,” Journal of Animal Science, vol. 95, no. 3, pp. 1080–1091, 2017. View at Publisher · View at Google Scholar
  • Ki-Tae Hwang, Wonshik Han, Jongjin Kim, Hyeong-Gon Moon, Sohee Oh, Yun Seon Song, Young A Kim, Mee Soo Chang, and Dong-Young Noh, “Prognostic Influence of BCL2 on Molecular Subtypes of Breast Cancer,” Journal of Breast Cancer, vol. 20, no. 1, pp. 54, 2017. View at Publisher · View at Google Scholar
  • Zhi-hui Zhang, Xin-yue Lian, Dong-ming Yao, Pin-fang He, Ji-chun Ma, Zi-jun Xu, Hong Guo, Wei Zhang, Jiang Lin, and Jun Qian, “Reduced intensity conditioning of allogeneic hematopoietic stem cell transplantation for myelodysplastic syndrome and acute myeloid leukemia in patients older than 50 years of age: a systematic review and meta-analysis,” Journal of Cancer Research and Clinical Oncology, 2017. View at Publisher · View at Google Scholar
  • Hamed Mirzaei, Sima Fathullahzadeh, Razieh Khanmohammadi, Mansoreh Darijani, Fatemeh Momeni, Aria Masoudifar, Mohammad Goodarzi, Omid Mardanshah, Jan Stenvang, Mahmoud Reza Jaafari, and Hamid Reza Mirzaei, “State of the art in microRNA as diagnostic and therapeutic biomarkers in chronic lymphocytic leukemia,” Journal of Cellular Physiology, 2017. View at Publisher · View at Google Scholar
  • Manoj Kandwal, Daljit Kaur, Lovenish Bains, and Indu Parmar, “Erythrocyte alloimmunization and autoimmunization among blood donors and recipients visiting a tertiary care hospital,” Journal of Clinical and Diagnostic Research, vol. 11, no. 3, pp. EC12–EC15, 2017. View at Publisher · View at Google Scholar
  • Jan S. Moreb, Michael Byrne, Ilicia Shugarman, Fei Zou, Sican Xiong, William S. May, Maxim Norkin, John Hiemenz, Randall Brown, Christopher Cogle, John R. Wingard, and Jack W. Hsu, “Poor peripheral blood stem cell mobilization affects long-term outcomes in multiple myeloma patients undergoing autologous stem cell transplantation,” Journal of Clinical Apheresis, 2017. View at Publisher · View at Google Scholar
  • James L.M. Ferrara, Christopher M. Smith, Julia Sheets, Pavan Reddy, and Jonathan S. Serody, “Altered homeostatic regulation of innate and adaptive immunity in lower gastrointestinal tract GVHD pathogenesis,” Journal of Clinical Investigation, 2017. View at Publisher · View at Google Scholar
  • Marcus Tan, Isaac K S Ng, Zhaojin Chen, Kenneth Ban, Christopher Ng, Lily Chiu, Elaine Seah, Mingxuan Lin, Bee Choo Tai, Benedict Yan, Chin Hin Ng, and Wee-Joo Chng, “ Clinical implications of DNMT3A mutations in a Southeast Asian cohort of acute myeloid leukaemia patients ,” Journal of Clinical Pathology, vol. 70, no. 8, pp. 669–676, 2017. View at Publisher · View at Google Scholar
  • Erin M. Lowery, William Adams, Shellee A. Grim, Nina M. Clark, Leah Edwards, and Jennifer E. Layden, “Increased risk of PTLD in lung transplant recipients with cystic fibrosis,” Journal of Cystic Fibrosis, 2017. View at Publisher · View at Google Scholar
  • Manoj P. Menon, Anna Coghill, Innocent O. Mutyaba, Warren T. Phipps, Fred M. Okuku, John M. Harlan, Jackson Orem, and Corey Casper, “Association Between HIV Infection and Cancer Stage at Presentation at the Uganda Cancer Institute,” Journal of Global Oncology, pp. JGO.17.00005, 2017. View at Publisher · View at Google Scholar
  • Mingxue Fan, Minghao Li, Lipeng Gao, Sicong Geng, Jing Wang, Yiting Wang, Zhiqiang Yan, and Lei Yu, “Chimeric antigen receptors for adoptive T cell therapy in acute myeloid leukemia,” Journal of Hematology & Oncology, vol. 10, no. 1, 2017. View at Publisher · View at Google Scholar
  • Meggie E. Doucet, and John J. Schmieg, “A rare case of acute promyelocytic leukemia with focal bone marrow involvement presenting as a paraspinal myeloid sarcoma,” Journal of Hematopathology, 2017. View at Publisher · View at Google Scholar
  • Connie M. Arthur, Jeanne E. Hendrickson, Seema R. Patel, Ashley Bennett, Nourine A. Kamili, Harold C. Sullivan, Andreas Wieland, Benjamin Youngblood, James C. Zimring, Sean R. Stowell, Nicole H. Smith, Amanda Mener, Christian Gerner-Smidt, and J. Scott Hale, “Antigen density dictates immune responsiveness following red blood cell transfusion,” Journal of Immunology, vol. 198, no. 7, pp. 2671–2680, 2017. View at Publisher · View at Google Scholar
  • Haifei Chen, Ailin Fu, Jing Wang, Tianqin Wu, Zhengyang Li, Jieqing Tang, Hongshi Shen, Jingjing Zhu, Jie Li, Qian Zhu, and Longmei Qing, “Rituximab as first-line treatment for acquired thrombotic thrombocytopenic purpura,” Journal of International Medical Research, pp. 030006051769564, 2017. View at Publisher · View at Google Scholar
  • Erika Reategui Schwarz, Katerina G. Oikonomou, Megan Reynolds, Juliette Kim, Rajeev L. Balmiki, and Stephanie A. Sterling, “ Extranodal NK/T-Cell Lymphoma, Nasal Type, Presenting as Refractory Pseudomonas aeruginosa Facial Cellulitis ,” Journal of Investigative Medicine High Impact Case Reports, vol. 5, no. 3, pp. 232470961771647, 2017. View at Publisher · View at Google Scholar
  • Yingying Ma, and Lihong Hou, “Prognosis of FLT3, NPM1, DNMT3A and IDH mutations in non-M3 acute myeloid leukemia,” Journal of Leukemia and Lymphoma, vol. 26, no. 4, pp. 252–256, 2017. View at Publisher · View at Google Scholar
  • Theodora Barkoulas, and Philip D Hall, “Experience with dasatinib and nilotinib use in pregnancy,” Journal of Oncology Pharmacy Practice, pp. 107815521769239, 2017. View at Publisher · View at Google Scholar
  • Murat Yurdakök, “Immune thrombocytopenia in the newborn,” Journal of Pediatric and Neonatal Individualized Medicine, vol. 6, no. 1, 2017. View at Publisher · View at Google Scholar
  • M V Vyalkina, I B Alchinova, E N Yakovenko, Yu S Medvedeva, I N Saburina, and M Yu Karganov, “Long-Term Effects of Stem Cells on Total-Body Irradiated Mice,” Journal of Physics: Conference Series, vol. 784, pp. 012015, 2017. View at Publisher · View at Google Scholar
  • Xiaoya Zhou, Lili Chen, Sibylle Grad, Mauro Alini, Haobo Pan, Dazhi Yang, Wanxin Zhen, Zhizhong Li, Shishu Huang, and Songlin Peng, “The roles and perspectives of microRNAs as biomarkers for intervertebral disc degeneration,” Journal of Tissue Engineering and Regenerative Medicine, 2017. View at Publisher · View at Google Scholar
  • Zeynep Ozturk, Gizem Esra Genc, and Saadet Gumuslu, “Minerals in thalassaemia major patients: An overview,” Journal of Trace Elements in Medicine and Biology, vol. 41, pp. 1–9, 2017. View at Publisher · View at Google Scholar
  • Jon D. Simmons, Yann-leei L. Lee, Viktor M. Pastukh, Gina Capley, Cherry A. Muscat, David C. Muscat, Michael L. Marshall, Sidney B. Brevard, and Mark N. Gillespie, “Potential contribution of mitochondrial DNA damage associated molecular patterns in transfusion products to the development of acute respiratory distress syndrome after multiple transfusions,” Journal of Trauma and Acute Care Surgery, vol. 82, no. 6, pp. 1023–1029, 2017. View at Publisher · View at Google Scholar
  • Ines G. Alamo, Kolenkode B. Kannan, Tyler J. Loftus, Harry Ramos, Philip A. Efron, and Alicia M. Mohr, “Severe trauma and chronic stress activates extramedullary erythropoiesis,” Journal of Trauma and Acute Care Surgery, vol. 83, no. 1, pp. 144–150, 2017. View at Publisher · View at Google Scholar
  • Michael L. Ekaney, Martin A. Grable, William F. Powers, Iain H. McKillop, and Susan L. Evans, “Cytochrome c and resveratrol preserve platelet function during cold storage,” Journal of Trauma and Acute Care Surgery, vol. 83, no. 2, pp. 271–277, 2017. View at Publisher · View at Google Scholar
  • Thomas F.X. O'Donnell, Katie E. Shean, Sarah E. Deery, Thomas C.F. Bodewes, Mark C. Wyers, Kerry L. O'Brien, Robina Matyal, and Marc L. Schermerhorn, “A preoperative risk score for transfusion in infrarenal endovascular aneurysm repair to avoid type and cross,” Journal of Vascular Surgery, 2017. View at Publisher · View at Google Scholar
  • Bérengère Koehl, Florence Missud, Laurent Holvoet, Ghislaine Ithier, Emmanuelle Lesprit, André Baruchel, Oliver Sakalian-Black, Zinedine Haouari, and Malika Benkerrou, “Continuous manual exchange transfusion for patients with sickle cell disease: An efficient method to avoid iron overload,” Journal of Visualized Experiments, vol. 2017, no. 121, 2017. View at Publisher · View at Google Scholar
  • Hye Sun Park, Marta Braschi-Amirfarzan, Lacey McIntosh, Atul B. Shinagare, and Katherine M. Krajewski, “T-cell non-hodgkin lymphomas: Spectrum of disease and the role of imaging in the management of common subtypes,” Korean Journal of Radiology, vol. 18, no. 1, pp. 71–83, 2017. View at Publisher · View at Google Scholar
  • Patrizia Romani, Marilena Ignesti, Giuseppe Gargiulo, Tien Hsu, and Valeria Cavaliere, “Extracellular NME proteins: a player or a bystander?,” Laboratory Investigation, 2017. View at Publisher · View at Google Scholar
  • J Wolfson, C-L Sun, L Wyatt, W Stock, and S Bhatia, “Impact of treatment site on disparities in outcome among adolescent and young adults with Hodgkin lymphoma,” Leukemia, 2017. View at Publisher · View at Google Scholar
  • A Gratwohl, A Sureda, J Cornelissen, J Apperley, P Dreger, R Duarte, H T Greinix, E Mc Grath, N Kroeger, F Lanza, A Nagler, J A Snowden, D Niederwieser, and R Brand, “Alloreactivity: the Janus-face of hematopoietic stem cell transplantation,” Leukemia, 2017. View at Publisher · View at Google Scholar
  • Medeiros, DiNardo, Pollyea, Chan, Swords, and Fathi, “Isocitrate dehydrogenase mutations in myeloid malignancies,” Leukemia, vol. 31, no. 2, pp. 272–281, 2017. View at Publisher · View at Google Scholar
  • Pillon, D'Amore, Basso, Pomari, Bonvini, Mussolin, Basso, Bresolin, Carraro, Viola, and Frasson, “NPM-ALK expression levels identify two distinct subtypes of paediatric anaplastic large cell lymphoma,” Leukemia, vol. 31, no. 2, pp. 498–501, 2017. View at Publisher · View at Google Scholar
  • J Rinke, J P Müller, M F Blaess, A Chase, M Meggendorfer, V Schäfer, N Winkelmann, C Haferlach, N C P Cross, A Hochhaus, and T Ernst, “Molecular characterization of EZH2 mutant patients with myelodysplastic/myeloproliferative neoplasms,” Leukemia, 2017. View at Publisher · View at Google Scholar
  • Silvia Salmoiraghi, Alessandro Rambaldi, and Orietta Spinelli, “ TP53 in adult acute lymphoblastic leukemia ,” Leukemia & Lymphoma, pp. 1–12, 2017. View at Publisher · View at Google Scholar
  • Samantha J. Jones, Jackson Voong, Ruth Thomas, Amy English, Johanna Schuetz, Graham W. Slack, Jinko Graham, Joseph M. Connors, and Angela Brooks-Wilson, “Nonrandom occurrence of lymphoid cancer types in 140 families,” Leukemia & Lymphoma, pp. 1–10, 2017. View at Publisher · View at Google Scholar
  • Antonio Almeida, Pierre Fenaux, Alan F. List, Azra Raza, Uwe Platzbecker, and Valeria Santini, “Recent advances in the treatment of lower-risk non-del(5q) myelodysplastic syndromes (MDS),” Leukemia Research, vol. 52, pp. 50–57, 2017. View at Publisher · View at Google Scholar
  • Qing-qing Zheng, You-shan Zhao, Juan Guo, Si-da Zhao, Lu-xi Song, Cheng-ming Fei, Zheng Zhang, Xiao Li, and Chun-kang Chang, “Iron overload promotes erythroid apoptosis through regulating HIF-1a/ROS signaling pathway in patients with myelodysplastic syndrome,” Leukemia Research, vol. 58, pp. 55–62, 2017. View at Publisher · View at Google Scholar
  • Emanuele Angelucci, Paolo Cianciulli, Carlo Finelli, Cristina Mecucci, Maria Teresa Voso, and Sante Tura, “Unraveling the mechanisms behind iron overload and ineffective hematopoiesis in myelodysplastic syndromes,” Leukemia Research, vol. 62, pp. 108–115, 2017. View at Publisher · View at Google Scholar
  • Gayatri Ramakrishnan, Nagasuma Chandra, and Narayanaswamy Srinivasan, “Exploring anti-malarial potential of FDA approved drugs: an in silico approach,” Malaria Journal, vol. 16, no. 1, 2017. View at Publisher · View at Google Scholar
  • Dingkun Fu, Andrew Bridle, Melanie Leef, Marthe Monique Gagnon, Kathryn L. Hassell, and Barbara F. Nowak, “Using a multi-biomarker approach to assess the effects of pollution on sand flathead ( Platycephalus bassensis ) from Port Phillip Bay, Victoria, Australia,” Marine Pollution Bulletin, 2017. View at Publisher · View at Google Scholar
  • S. Pujari-Palmer, X. Lu, V.P. Singh, L. Engman, M. Pujari-Palmer, and M. Karlsson Ott, “Incorporation and delivery of an organoselenium antioxidant from a brushite cement,” Materials Letters, 2017. View at Publisher · View at Google Scholar
  • Carla Solange Escórcio-Dourado, Luana Mota Martins, Camila Maria Simplício-Revoredo, Fabiane Araújo Sampaio, Cléciton Braga Tavares, João Paulo da Silva-Sampaio, Umbelina Soares Borges, Francisco Adelton Alves-Ribeiro, Pedro Vitor Lopes-Costa, José Charles Lima-Dourado, and Benedito Borges da Silva, “Bcl-2 antigen expression in luminal A and triple-negative breast cancer,” Medical Oncology, vol. 34, no. 9, 2017. View at Publisher · View at Google Scholar
  • Muaz Belviranli, Nilsel Okudan, and Banu Kabak, “The Effects of Acute High-Intensity Interval Training on Hematological Parameters in Sedentary Subjects,” Medical Sciences, vol. 5, no. 3, pp. 15, 2017. View at Publisher · View at Google Scholar
  • Emilie Virot, Antoine Duclos, Leopold Adelaide, Patrick Miailhes, Arnaud Hot, Tristan Ferry, and Pascal Seve, “Autoimmune diseases and HIV infection,” Medicine, vol. 96, no. 4, pp. e5769, 2017. View at Publisher · View at Google Scholar
  • Silvana Anna Maria Urru, Federica Pilo, Alberto Piperno, and Emanuele Angelucci, “Myelodysplastic syndromes and iron chelation therapy,” Mediterranean Journal of Hematology and Infectious Diseases, vol. 9, no. 1, 2017. View at Publisher · View at Google Scholar
  • Mirella Ampatzidou, Charikleia Kelaidi, Michael N. Dworzak, and Sophia Polychronopoulou, “Adolescents and young adults with acute lymphoblastic leukemia and acute myeloid leukemia,” memo - Magazine of European Medical Oncology, 2017. View at Publisher · View at Google Scholar
  • Donna M Weber, Sheeba K Thomas, Elisabet E Manasanch, Suyang Hao, Qi Shen, Robert Z Orlowski, Pei Lin, Xinyan Lu, Adrian A Carballo-Zarate, L Jeffrey Medeiros, Lianghua Fang, and Jatin J Shah, “Additional–structural–chromosomal aberrations are associated with inferior clinical outcome in patients with hyperdiploid multiple myeloma: a single-institution experience,” Modern Pathology, 2017. View at Publisher · View at Google Scholar
  • Bo Yang, Jinhong Yao, Bai Li, Guoguang Shao, and Yongsheng Cui, “Inhibition of protein kinase CK2 sensitizes non-small cell lung cancer cells to cisplatin via upregulation of PML,” Molecular and Cellular Biochemistry, 2017. View at Publisher · View at Google Scholar
  • Shile Huang, Ji-Long Chen, and Xuefei Wang, “Understanding of leukemic stem cells and their clinical implications,” Molecular Cancer, vol. 16, no. 1, 2017. View at Publisher · View at Google Scholar
  • Robert B. Sim, Janez Ferluga, Lubna Kouser, Valarmathy Murugaiah, and Uday Kishore, “Potential influences of complement factor H in autoimmune inflammatory and thrombotic disorders,” Molecular Immunology, vol. 84, pp. 84–106, 2017. View at Publisher · View at Google Scholar
  • Katrin Schaar, Anja Geisler, Milena Kraus, Sandra Pinkert, Markian Pryshliak, Jacqueline F. Spencer, Ann E. Tollefson, Baoling Ying, Jens Kurreck, William S. Wold, Robert Klopfleisch, Karoly Toth, and Henry Fechner, “Anti-adenoviral Artificial MicroRNAs Expressed from AAV9 Vectors Inhibit Human Adenovirus Infection in Immunosuppressed Syrian Hamsters,” Molecular Therapy - Nucleic Acids, vol. 8, pp. 300–316, 2017. View at Publisher · View at Google Scholar
  • Ž. Snoj, G. Riegler, T. Moritz, and G. Bodner, “Brachial plexus ultrasound in a patient with myelodysplastic syndrome and myelosarcoma,” Muscle & Nerve, 2017. View at Publisher · View at Google Scholar
  • Rania Kheder El-Fekih, Clément Deltombe, and Hassan Izzedine, “Microangiopathie thrombotique et cancer,” Néphrologie & Thérapeutique, 2017. View at Publisher · View at Google Scholar
  • Joseph D. Tariman, “Changes in Cancer Treatment,” Nursing Clinics of North America, vol. 52, no. 1, pp. 65–81, 2017. View at Publisher · View at Google Scholar
  • Akhilendra Kumar Maurya, and Manjula Vinayak, “Quercetin Attenuates Cell Survival, Inflammation, and Angiogenesis via Modulation of AKT Signaling in Murine T-Cell Lymphoma,” Nutrition and Cancer, pp. 1–11, 2017. View at Publisher · View at Google Scholar
  • Jinqiu Chen, Miling Zhang, Wang Gang Zhang, Fuling Zhou, Jin Wang, and Ben Niu, “Immunological effects of vaccines combined with granulocyte colony-stimulating factor on a murine WEHI-3 leukemia model,” Oncology Letters, vol. 13, no. 4, pp. 2323–2329, 2017. View at Publisher · View at Google Scholar
  • Cheng Zhang, Zhang, Shi-Jie Yang, and Xing-Hua Chen, “Growth of tyrosine kinase inhibitor-resistant philadelphia-positive acute lymphoblastic leukemia: Role of bone marrow stromal cells,” Oncology Letters, vol. 13, no. 4, pp. 2059–2070, 2017. View at Publisher · View at Google Scholar
  • Christoph Wyen, Manfred Hensel, and Tanya Welz, “Drug Interactions in the Treatment of Malignancy in HIV-Infected Patients,” Oncology Research and Treatment, vol. 40, no. 3, pp. 120–127, 2017. View at Publisher · View at Google Scholar
  • Immacolata Giordano, Elvira Donnarumma, Alessandra Affinito, Matilde Todaro, Giuseppina Roscigno, Maria D. Vivanco, Gerolama Condorelli, Ilaria Puoti, Valentina Russo, Assunta Adamo, and Cristina Quintavalle, “MiR-24 induces chemotherapy resistance and hypoxic advantage in breast cancer,” Oncotarget, vol. 8, no. 12, pp. 19507–19521, 2017. View at Publisher · View at Google Scholar
  • Zuzana Rychtarcikova, Vlasta Korenkova, Polina Zjablovskaja, Jaroslav Truksa, Sandra Lettlova, Veronika Tomkova, Lucie Langerova, Ekaterina Simonova, Meritxell Alberich-Jorda, and Jiri Neuzil, “Tumor-initiating cells of breast and prostate origin show alterations in the expression of genes related to iron metabolism,” Oncotarget, vol. 8, no. 4, pp. 6376–6398, 2017. View at Publisher · View at Google Scholar
  • Qiong Liao, Bingping Wang, Xia Li, and Guosheng Jiang, “miRNAs in acute myeloid leukemia,” Oncotarget, vol. 8, no. 2, pp. 3666–3682, 2017. View at Publisher · View at Google Scholar
  • Zhidong Wang, Yehui Tan, Wei Li, Hai Lin, Hongmin Yan, Jinglong Guo, Zheng Hu, Chunhui Jin, Yongqi Wang, Fengyan Jin, Yangzhi Zhao, Yu Liu, Xiaoli Zheng, Yun Dai, Yanping Yang, Sujun Gao, and Hengxiang Wang, “Characterization of IFNγ-producing natural killer cells induced by cytomegalovirus reactivation after haploidentical hematopoietic stem cell transplantation,” Oncotarget, vol. 8, no. 1, pp. 51–63, 2017. View at Publisher · View at Google Scholar
  • Jae-Sook Ahn, Seung Hyun Choi, Chul Won Jung, Jun-Ho Jang, Hee Je Kim, Joon Ho Moon, Sang Kyun Sohn, Jong-Ho Won, Sung-Hyun Kim, Szardenings Michael, Mark D. Minden, Hyeoung-Joon Kim, Dennis Dong Hwan Kim, Yeo-Kyeoung Kim, Seung-Shin Lee, Seo- Yeon Ahn, Sung-Hoon Jung, Deok-Hwan Yang, Je-Jung Lee, and Hee Jeong Park, “5-Hydroxymethylcytosine correlates with epigenetic regulatory mutations, but may not have prognostic value in predicting survival in normal karyotype acute myeloid leukemia,” Oncotarget, vol. 8, no. 5, pp. 8305–8314, 2017. View at Publisher · View at Google Scholar
  • Aida Dikic, Cathrine B. Vågbø, Mirta M.L. Sousa, Anders Waage, Alexey Zatula, Celine Mulder, Animesh Sharma, and Geir Slupphaug, “Proteome alterations associated with transformation of multiple myeloma to secondary plasma cell leukemia,” Oncotarget, vol. 8, no. 12, pp. 19427–19442, 2017. View at Publisher · View at Google Scholar
  • Asokan Manimaran, and Shanmugam Manoharan, “Tumor Preventive Efficacy of Emodin in 7,12-Dimethylbenz[a]Anthracene-Induced Oral Carcinogenesis: a Histopathological and Biochemical Approach,” Pathology & Oncology Research, 2017. View at Publisher · View at Google Scholar
  • Deniz Aslan, “Addition of oral iron to plasma transfusion in human congenital hypotransferrinemia: A 10-year observational follow-up with the effects on hematological parameters and growth,” Pediatric Blood & Cancer, pp. e26789, 2017. View at Publisher · View at Google Scholar
  • O.C. Odunlade, O.O. Adeodu, J.A. Owa, and E.M. Obuotor, “Iron overload in steady state, non-chronically transfused children with sickle cell anaemia in Ile-Ife, Nigeria,” Pediatric Hematology Oncology Journal, 2017. View at Publisher · View at Google Scholar
  • Vanessa Corrales-Agudelo, Beatriz Elena Parra-Sosa, and Luis Carlos Burgos-Herrera, “Proteínas relacionadas con el metabolismo del hierro corporal,” Perspectivas en Nutrición Humana, vol. 18, no. 1, pp. 95–116, 2017. View at Publisher · View at Google Scholar
  • Roberta Ettari, Maria Zappalà, Silvana Grasso, Caterina Musolino, Vanessa Innao, and Alessandro Allegra, “Immunoproteasome-selective and non selective inhibitors: A promising approach for the treatment of multiple myeloma,” Pharmacology & Therapeutics, 2017. View at Publisher · View at Google Scholar
  • J. Christopher Taylor, L. Savannah Dewberry, Stacie K. Totsch, Lindsey R. Yessick, Jennifer J. DeBerry, Stephen A. Watts, and Robert E. Sorge, “A novel zebrafish-based model of nociception,” Physiology & Behavior, 2017. View at Publisher · View at Google Scholar
  • Pierre Gallian, Isabelle Leparc-Goffart, Pascale Richard, Françoise Maire, Olivier Flusin, Rachid Djoudi, Jacques Chiaroni, Remi Charrel, Pierre Tiberghien, and Xavier de Lamballerie, “Epidemiology of Chikungunya Virus Outbreaks in Guadeloupe and Martinique, 2014: An Observational Study in Volunteer Blood Donors,” PLOS Neglected Tropical Diseases, vol. 11, no. 1, pp. e0005254, 2017. View at Publisher · View at Google Scholar