<i>Chlamydia trachomatis</i> Growth and Cytokine mRNA Response in a Prostate Cancer Cell Line

Petyaev, Ivan M.; Zigangirova, Naylia A.; Morgunova, Elena Y.; Kyle, Nigel H.; Fedina, Elena D.; Bashmakov, Yuriy K.

doi:https://doi.org/10.1155/2019/6287057

Advances in Urology

On this page

Abstract Introduction Materials and Methods Results Discussion Data Availability Conflicts of Interest Acknowledgments References Copyright Related Articles

Research Article | Open Access

Volume 2019 | Article ID 6287057 | https://doi.org/10.1155/2019/6287057

Chlamydia trachomatis Growth and Cytokine mRNA Response in a Prostate Cancer Cell Line

Ivan M. Petyaev,¹Naylia A. Zigangirova,²Elena Y. Morgunova,²Nigel H. Kyle,¹Elena D. Fedina,²and Yuriy K. Bashmakov¹

Academic Editor: Kostis Gyftopoulos

Received16 Aug 2018

Revised27 Nov 2018

Accepted25 Dec 2018

Published17 Jan 2019

Abstract

In the present paper, we report that C. trachomatis can be efficiently propagated and affect mRNA expression for two major cytokines, relevant to tumor progression, in CWR-R1 cells, a malignant prostate cell line. CWR-R1 and McCoy cells, a classic cell line for chlamydial research, were grown and infected with C. trachomatis under similar conditions. Cell monolayers were harvested for RNA analysis and immunostaining with major outer membrane protein (MOMP) antibody at 24, 48, and 72 hours of the postinfection (hpi) period. It was shown that the infectious cycle of chlamydial pathogen in CWR-R1 cells resembles the progression of C. trachomatis infection in McCoy cells but with a few important differences. First of all, the initial stage of C. trachomatis propagation in CWR-R1 cells (24 hpi) was characterized by larger inclusion bodies and more intense, specific immunofluorescent staining of infected cells as compared with McCoy cells. Moreover, there was a corresponding increase in infective progeny formation in CWR-R1 cells along with mRNA for EUO, a crucial gene controlling the early phase of the chlamydial development cycle (24 hpi). These changes were more minimal and became statistically insignificant at a later time point in the infectious cycle (48 hpi). Altogether, these data suggest that the early phase of C. trachomatis infection in CWR-R1 cells is accompanied by more efficient propagation of the pathogen as compared with the growth of C. trachomatis in McCoy cells. Furthermore, propagation of C. trachomatis in CWR-R1 cells leads to enhanced transcription of interleukin-6 and fibroblast growth factor-2, genes encoding two important proinflammatory cytokines implicated in the molecular mechanisms of chemoresistance of prostate cancer and its ability to metastasize. The possible roles of reactive oxygen species and impaired mitochondrial oxidation in the prostate cancer cell line are discussed as factors promoting the early stages of C. trachomatis growth in CWR-R1 cells.

1. Introduction

Chlamydia trachomatis (C. trachomatis) is an obligate, nonspore-forming intracellular Gram-negative bacterial pathogen able to propagate in epitheliocytes of mucous membranes (urogenital system and eye) and which displays a distinct parasitic cell cycle [1, 2]. C. trachomatis is the most prevalent sexually transmitted pathogen causing a wide range of syndromes and diseases, with an alarming growth rate of 100 million newly reported cases annually worldwide [3, 4]. Although most C. trachomatis infections are asymptomatic, untreated individuals may develop a variety of genital (urethritis, endocervicitis, salpingitis, endometritis, and pelvic inflammatory disease) and extragenital (arthritis, perihepatitis, and ocular infection) manifestations [5]. There are 17 C. trachomatis serovars. All of them have a similar and unique life cycle and exist in two developmental forms—elementary body and reticulate body [6]. Eukaryotic cells are infected with nondividing elementary bodies which form phagolysosomal fusion particles in the cytoplasm of the host cell at the initial stage of infection. Inside, the endosome elementary bodies differentiate into reticulate bodies which divide via binary fission [1, 7]. Once infection progresses and the endosome (otherwise known as the inclusion body) accumulates a significant number of reticulate bodies, a reverse transformation of reticulate bodies into elementary bodies takes place. Newly formed elementary bodies undergo exocytosis after 48–72 hours of postinfection development to initiate a new round of C. trachomatis infection in neighboring cells. Such a sophisticated developmental cycle is highly energy dependent and known to be supported by host cell metabolism [8]. All members of Chlamydiaceae rely heavily on the host cell metabolism. The chlamydial genome lacks most of the genes encoding cholesterol biosynthesis although chlamydial species can synthetize some phospholipids, long chain fatty acids and branched fatty acids [8–10]. Chlamydiaceae are completely auxotrophic for purine and pyrimidine nucleotides, most amino acids, and utilize host cell cytosolic ATP for at least the early stages of infection [11].

A large number of nonhematopoietic cells can support C. trachomatis growth using in vitro systems. Most of the genital strains grow very efficiently in a McCoy mouse fibroblast cell line, which is a classic cell for stock expansion and maintenance [12]. Ocular strains of the pathogen show preferential growth in conjunctival cells [13]. Epithelial cell lines from the vagina, endocervix, and endometrium have been established to provide physiologically relevant models for the study of pathogenesis in genital forms of C. trachomatis infection [14]. There is a continuous pursuit of physiologically relevant in vitro systems for the investigation of pathogenesis and treatment of C. trachomatis infection.

In the present paper, we report that C. trachomatis can be efficiently propagated and affect host cell mRNA expression for two major cytokines, relevant for tumor progression, in CWR-R1 cells, a malignant prostate cell line.

2. Materials and Methods

2.1. Reagents and Organisms

All reagents were from Sigma-Aldrich (St. Louis, USA) unless specified otherwise. C. trachomatis strain L2/Bu434 was kindly provided by Dr. P Saikku (University of Oulu, Finland). CWR-R1 cells (a human prostate cancer epithelial cell line), as well as McCoy cells (a mouse fibroblast cell line), were obtained from the Cultured Cells Depository Collection (Moscow, Russia).

2.2. Cell Culture

C. trachomatis was propagated in McCoy mouse fibroblasts grown in DMEM with 10% HyClone FCS supplemented with 2 mM glutamine, 4.0 mg/ml gentamicin, and 5.0 mg/ml amphotericin B, and further purified by Renografin gradient centrifugation, as previously described [15]. Briefly, elementary bodies were isolated and resuspended in sucrose-phosphate-glutamic acid (SPG) buffer (0.2 M sucrose, 8.6 mM Na2HPO4, 3.8 mM KH2PO4, 5 mM glutamic acid, 0.2 mm-filtered, pH 7.4). Titers were determined by infecting cell monolayers with dilutions of thawed stock suspension (2.5 × 10⁷). Subconfluent McCoy cell monolayers were infected with the suspension of C. trachomatis at MOI 1. Plates were centrifuged for 1 hour at 1500 g to synchronize the infection. Nucleic acid-based assay (RT-PCR) was performed at 24, 48, and 72 hours following C. trachomatis inoculation of the cultured cells. The infection rate in the McCoy cells and infective progeny formation was estimated as hours of postinfection (hpi) period following pathogen introduction into the incubation medium. To avoid discrepancies, CWR-R1 cells were grown, infected, and monitored under similar conditions.

2.3. Immunofluoresence Staining

Infected McCoy and CWR-R1 cells were grown on coverslips in 24-well plates and used for analysis at 0, 24, 48, and 72 hpi. The cells were fixed with ice-cold methanol, permeabilized with 0.1% Triton X-100, and preblocked for 1 hour at 4°C with 1% bovine serum albumin in PBS. Cell monolayers were stained using FITC-conjugated monoclonal antibody against MOMP, a major outer membrane protein (Bio-Rad, USA). Inclusion-containing cells were visualized using a Nikon Eclipse 50i microscope (Nikon, Japan) at ×1000 or lower magnification. Size of the inclusion bodies was measured using a MicroScan attachment to the microscope with a resolution of 0.1 μm (Protvino, Russia) along with morphometric software (DiagNodus, Cambridge, UK).

2.4. Assessment of Infective Progeny

Infective progeny accumulation was assessed in McCoy and CWR-R1 cell monolayers infected with C. trachomatis at different time points. Infected cell monolayers were harvested 48 hours after bacterial inoculation and lysed by freezing/thawing. Serial dilutions of lysates were inoculated into McCoy cells, and plates were centrifuged for 1 hour at 1500 g. The infected cells were visualized at 48 hours of the postinfection period with FITC-conjugated monoclonal antibody against chlamydial MOMP, a major outer membrane protein (BioRad, USA).

2.4.1. Attachment and Internalization Assay

This assay was performed as described in our previous paper [16].

2.5. RNA Extraction and Reverse Transcription

RNA was isolated from C. trachomatis-infected McCoy cells or CWR-R1 monolayers grown on 6-well plates using TRIZol (Invitrogen, Waltham MS, USA) at the 24-hour time point of the postinfection period. Total mRNA was pretreated with DNase I (DNA-free™, Ambion, Waltham MS, USA) and quantified on a NanoDrop ND-100 spectrophotometer (Thermo Fisher Scientific, Waltham MS, USA). 1 μg of each RNA sample was converted into cDNA using random hexamer primers and a SuperScript III First-Strand Synthesis kit (Invitrogen, Waltham MS, USA).

2.5.1. Quantitative Real-Time PCR

mRNA levels for EUO, a developmental gene of C. trachomatis, were analyzed in McCoy and CWR-R1 cells at different hpi by quantitative RT-PCR using a CFX-96 thermocycler and master mixes from Bio-Rad Laboratories (Hercules CA, USA). RT-qPCR Taqman primers were designed using Primer 3 software and were validated by BLAST search and regression plot analysis using Cp values obtained with multiple dilutions of cDNA. Specificity of the designed primers and fluorescent probes was confirmed in different systems using cDNA from C. trachomatis Bu434, C. trachomatis UW-3/Cx, C. trachomatis UW- 31/Cx, and C. pneumoniae K-6, as well as from uninfected McCoy and CWR-R1 cells and some other common bacterial pathogens as previously described [15].

The C. trachomatis-specific primers used were as follows: for EUO gene: Pr-F 5′ TCCCCGACGCTCTCCTTTCA 3′, Pr-R 5′CTCGTCAGGCTATCTATGTTGCT 3′, Probe 5′-ROX- ATG GAC GCC ACT TGT CCC ACG GAA T-BHQ2-3′. Primers for human interleukin-6 (IL-6) were as follows: PR-F 5′-CCAGCTATGAACTCCTTCTC-3′, PR-R 5′-GCTTGTTCCTCACATCTCTC-3′. Primers for human fibroblast growth factor-2 (FGF-2) were: PR-F 5′-GGCTTCTTCCTGCGCATCCA-3′ and PR-R 5′-GCTCTTAGCAGACATTGGAAGA-3′. Primer sequences for eukaryotic beta-actin were used as published previously [15, 16]. All primers were verified and used at 0.4 µM final concentration under thermal cycling conditions of 95°C for 10 min, 50 cycles of 95°C for 15 seconds, 60°C for 1 min, and 72°C for 20 seconds. Serial dilutions of RNA extracted from C. trachomatis-infected McCoy and CWR-R1 cells were used as a standard for quantification of chlamydial gene expression. The mRNA expression levels were referenced to Ct values for chlamydial genes detected in uninfected McCoy cells grown under similar conditions. This reference value was taken as 1.00. All mRNA measurements were done in triplicate. All experiments were conducted at least three times. Statistical analysis was performed where possible using Student’s t-test and calculation of medians as well as 95% confidence intervals. The most representative sets of immunofluorescence images were selected and are shown above.

3. Results

3.1. Morphological Assessment

The morphological characteristics of C. trachomatis growth in McCoy and CWR-R1 cells were monitored in immunofluorescence experiments conducted side by side. There was no difference in the attachment/entry of EB into McCoy and CWR-R1 cells at the early time points of infection corresponding to 6, 9, and 12 hpi (results not shown). Almost equal numbers of infected cells were seen in both cells lines at the different MOI used (0.5 and 1.0). Also, there was no statistical difference in the number of infected cells in the cell lines investigated. For example, at 24 hpi, the number of infected cells seen in the McCoy line at MOI = 1 was 26.3 (95% CI : 29.4/22.9), whereas the corresponding infectivity rate in CWR-R1 cells observed under the same conditions was 28.1 (95% CI : 30.1/21.4, ). Despite the similar number of infected cells assessed by IF at all time points, the inclusion bodies developing in McCoy cells at the initial stage of infection (24 hpi) tended to be less mature, with a patchy and more granular pattern of staining. Moreover, there was greater variability in the pattern of inclusion body staining in McCoy cells. In contrast, the majority of CWR-R1 cells at this time point had a less variable and stronger pattern of staining. They contained more mature inclusion particles with higher IF density and a more globular appearance, suggesting altogether a better synchronization of infection (Figure 1). At the late stage of the infectious cycle (72 hpi), the difference in the intensity of IF staining of the inclusion bodies was less obvious. However, the majority of McCoy cells were disrupted with visible exocytosis of EB, whereas EB in the CWR-R1 cells appeared to be more contained within cell remnants.

(a)

(b)

The results shown in Figure 2 document the difference in chlamydial inclusion size seen in both cell lines during the infectious cycle. As can be seen, under the culture conditions used, the inclusions in CWR-R1 cells were significantly larger () than the inclusion bodies formed in McCoy cells at 24 and 48 hpi.

3.2. Infective Progeny Formation

Figure 3 shows the difference in infective progeny formation in McCoy and CWR-R1 cells at 24 and 48 hpi. There was a statistically significant () increase in the median reflecting infective progeny formation in CWR-R1 cells (7.7 × 10⁵, 95% CI : 9.1/6.3) in comparison with McCoy cells (4.6 × 10⁵, 95% CI : 5.4/3.7) at the early stage of infection (24 hpi). However, the later stage of chlamydial infection (48 hpi) was not accompanied by a statistically significant difference in infective progeny formation in the cell lines studied ().

3.3. EUO Expression

The results reported above reveal that the greatest differences in the infectious cycle of C. trachomatis in McCoy and CWR-R1 cells are evident at the initial stage of pathogen propagation in the host cells. Therefore, we decided to investigate next the mRNA levels for EUO, a key chlamydial gene controlling multiple gene transcription during the early stage of C. trachomatis propagation in eukaryotic cells [16].

As can be seen from Figure 4, the highest level of EUO expression in both cell lines was seen in our experiments at 12 hpi, and especially at 24 hpi. At both time points, EUO expression was noticeably higher in CWR-R1 cells than that in McCoy cells (by 2.1- and 1.8-folds, respectively). Interestingly, even at the earliest time point investigated (3 hpi), CWR-R1 cells had a higher level of copies for EUO mRNA (by 30%) than that in with McCoy cells. EUO mRNA remained almost equally elevated but subsided somewhat from the values measured at 24 hpi (up to 4.1- and 4.5-folds in McCoy and CWR-R1 cells, respectively) at 48 hpi.

3.4. Host Cell Cytokine mRNA Expression

Since C. trachomatis is known to affect cytokine gene expression in host cells during the postinfection period [17], we decided to investigate next the mRNA levels of IL-6 and FGF-2, two crucial proinflammatory cytokines, following exposure of McCoy and CWR-R1 cells to the pathogen.

As can be seen from Figure 5, both genes (IL-6 and FGF-2) are constitutively expressed in uninfected McCoy and CWR-R1 cells. Both proinflammatory mRNAs were upregulated in infected McCoy cells (up to 1.3- and 1.5-folds for IL-6 and FGF-2, respectively). However, increases were much more pronounced in the infected CWR-R1 cells. The mRNA level for IL-6 went up to 9.7-fold and mRNA for FGF-2 was upregulated by 6.3-fold as compared with mRNA values detected in the uninfected cells. Since the two cell lines used in the studies are of different origin (mouse versus human) and require different primer sets for mRNA quantification with possible differences in annealing efficiency, it would be questionable to conduct direct quantitative assessment of the mRNA responses in McCoy and CWR-R1 cells in terms other than fold increase over basal values detected for each cell line.

(a)

(b)

4. Discussion

Prostate cancer (PC) is the most common noncutaneous cancer in men and the third most common cause of cancer-related death in males residing in the USA and the UK [18]. Newly diagnosed individuals with localized PC have a high 10-year survival rate and a high chance of complete recovery whereas men with metastatic “aggressive” forms of PC tend to have much poorer outcomes [19, 20]. The molecular and cellular mechanisms of initiation, progression, and outcomes of PC are poorly understood. Chronic prostate inflammation (prostatitis), sedentary lifestyle, obesity, high-fat diet, and smoking are among epidemiological factors predisposing to PC [21, 22]. Chlamydia trachomatis is currently considered to be among common and frequent uropathogens causing chronic and difficult to treat bacterial prostatitis [23]. Although the frequency of confirmed cases of chlamydial prostatitis in the general population seems to be low, C. trachomatis can ascend the male urogenital tract and affect the bladder, prostate, seminal vesicles, epididymis, and testicles [24, 25].

In the present paper, we report that C. trachomatis can efficiently propagate in CWR-R1 cells, a PC cell line. This observation is in good agreement with results describing C. trachomatis growth in PC-3 cells, another PC cell line (26). Overall, the infectious cycle of chlamydial pathogen in CWR-R1 cells resembles the progression of C. trachomatis infection in McCoy cells, a classic cell line for chlamydial research, with a few important differences. First of all, the initial stage of C. trachomatis propagation in CWR-R1 cells (24 hpi) was characterized by larger inclusion bodies and higher intensity of IF staining of the infected cells as compared with McCoy cells. Moreover, there was a corresponding increase in infective progeny formation in CWR-R1 cells along with mRNA for EUO, a crucial gene controlling the early phase of the chlamydial development cycle. It remains an open question now if other developmental chlamydial genes (incA and omcB) studied in our previous work [15] have a different pattern of expression in McCoy and CWR-R1 cells during the later stages of infectious cycle. Interestingly, the changes in EUO expression between two cell lines studied were minimized and became statically insignificant at a later time point in the infectious cycle (48 hpi). Altogether, these data suggest that the early phase of C. trachomatis infection in CWR-R1 cells is accompanied by more efficient propagation of the pathogen as compared with the growth of C. trachomatis in McCoy cells. This conclusion comprises a novelty in our research. The underlying mechanism of these phenomena may be related to biochemical characteristics of PC cells and the metabolic requirements for C. trachomatis growth in the early stages of infection. CWR-R1 cells are known constitutively to express functional elements of mitogen-activated protein kinase, phosphatidylinositol-3 kinase, and Akt pathways and to display hyperactivated Akt which develops due to an Akt-dependent increase in oxidative phosphorylation [26, 27]. These changes are known to cause an intracellular excess of reactive oxygen species (ROS) which are an essential stimulus for initiation and progression of the developmental cycle of C. trachomatis in the urogenital system [3, 28]. It has been shown recently that high ROS production promotes chlamydial growth and infective progeny formation via activation of caspase-1 and hypoxia-inducible factor 1α [29]. Moreover, PC cell lines have been shown to have an impaired mitochondrial respiration rate and exemplify the Warburg effect [27, 30], resulting in enhanced glycolysis, lactogenesis, and inefficient ATP synthesis. However, as recently reported, moderate hypoxia is highly beneficial for the chlamydial growth cycle in cultured cells and promotes the infection rate of both C. trachomatis and C. pneumoniae [28]. Additionally, as shown lately [11] C. trachomatis can sustain its own energy needs during the infectious cycle at least in part via sodium-dependent synthesis of ATP. Therefore, high competition for ATP metabolic pathways in PC cells need not be a limiting factor for chlamydial cycle progression in PC cell lines and seems rather to be a factor activating chlamydial growth.

Another aspect of our results reveals that propagation of C. trachomatis in CWR-R1 cells leads to enhanced transcription of IL-6 and FGF-2, genes encoding two important pro-inflammatory cytokines. IL-6 is a well-known inducer of chemoresistance, progression, and metastatic transformation of PC [31, 32]. On the other hand, FGF-2 is reported to promote vascularization of primary PC tumors and formation of metastatic lesions [33]. Therefore, the pattern of changes in cytokine mRNA profile seen in CWR-R1 cells infected with C. trachomatis clearly leads to predisposition to the advancement of PC. Similar results have been reported by Sellami H et al. who described enhanced transcription of VEGF mRNA in PC-3 cells, another PC cell line, infected with C. trachomatis [34]. However, it has to be emphasized that these results are of highly questionable relevance to clinical practice. Although a limited body of epidemiological evidence places past urogenital infections and sexually transmitted infections among the risk factors for PC, there is no proven epidemiological link between chlamydiosis and PC yet [35]. Additional epidemiological analysis is required to evaluate the possible interplay between C. trachomatis infection and PC outcomes and to determine the relevance of the observed changes to clinical practice. Nevertheless, the results reported above and the cell culture system proposed in our study could be a useful tool in experiments exploring the role of impaired host cell mitochondrial function in chlamydial growth as well as in understanding the general biology of chlamydial infection.

Data Availability

The original results will be available by request from corresponding author and will be placed on the public server https://lycotec.com.

Conflicts of Interest

The authors declare no conflicts of interest involved.

Acknowledgments

The study was a subject of internal funding by Lycotec Ltd. (UK) and Gamaleya National Research Center of Epidemiology and Microbiology (Russia).

References

I. Haferkamp, “Crossing the border—solute entry into the chlamydial inclusion,” International Journal of Medical Microbiology, vol. 308, no. 1, pp. 41–48, 2017.
View at: Publisher Site | Google Scholar
S. S. Witkin, E. Minis, A. Athanasiou, J. Leizer, and I. M. Linhares, “Chlamydia trachomatis: the persistent pathogen,” Clinical and Vaccine Immunology, vol. 24, no. 10, 2017.
View at: Publisher Site | Google Scholar
K. A. Redgrove and E. A. McLaughlin, “The role of the immune response in Chlamydia trachomatis infection of the male genital tract: a double-edged sword,” Frontiers in Immunology, vol. 5, p. 534, 2014.
View at: Publisher Site | Google Scholar
N. Ziklo, W. M. Huston, J. S. Hocking, and P. Timms, “Chlamydia trachomatis genital tract infections: when host immune response and the microbiome collide,” Trends in Microbiology, vol. 24, no. 9, pp. 750–765, 2016.
View at: Publisher Site | Google Scholar
A. B. Lane and C. F. Decker, “Chlamydia trachomatis infections,” Disease-a-Month, vol. 62, no. 8, pp. 269–273, 2016.
View at: Publisher Site | Google Scholar
C. Elwell, K. Mirrashidi, and J. Engel, “Chlamydia cell biology and pathogenesis,” Nature Reviews Microbiology, vol. 14, no. 6, pp. 385–400, 2016.
View at: Publisher Site | Google Scholar
A. Nunes and J. P. Gomes, “Evolution, phylogeny, and molecular epidemiology of Chlamydia,” Infection, Genetics and Evolution, vol. 23, pp. 49–64, 2014.
View at: Publisher Site | Google Scholar
N. Käding, M. Szaszák, and J. Rupp, “Imaging of Chlamydia and host cell metabolism,” Future Microbiology, vol. 9, no. 4, pp. 509–521, 2014.
View at: Publisher Site | Google Scholar
E. M. Fozo and E. A. Rucks, “The making and taking of lipids: the role of bacterial lipid synthesis and the harnessing of host lipids in bacterial pathogenesis,” Advances in Microbial Physiology, vol. 69, pp. 51–155, 2016.
View at: Publisher Site | Google Scholar
L. König, A. Siegl, T. Penz et al., “Biphasic metabolism and host interaction of a chlamydial symbiont,” mSystems, vol. 2, no. 3, pp. e00202–e00216, 2017.
View at: Publisher Site | Google Scholar
P. Liang, M. Rosas-Lemus, D. Patel, X. Fang, K. Tuz, and O. Juárez, “Dynamic energy dependency of Chlamydia trachomatis on host cell metabolism during intracellular growth: role of sodium-based energetics in chlamydial ATP generation,” Journal of Biological Chemistry, vol. 293, no. 2, pp. 510–522, 2017.
View at: Publisher Site | Google Scholar
T. Mestrović, S. Ljubin-Sternak, M Sviben et al., “Antimicrobial sensitivity profile of Chlamydia trachomatis isolates from Croatia in McCoy cell culture system and comparison with the literature,” Clinical Laboratory, vol. 62, no. 3, pp. 357–364, 2016.
View at: Publisher Site | Google Scholar
T. G. Moffa, F. J. DeToma, S. Ellen Frederick, and M. Howe, “Growth of an ocular strain of Chlamydia trachomatis on Chang conjunctival cells,” Ophthalmic Research, vol. 21, no. 5, pp. 388–391, 1989.
View at: Publisher Site | Google Scholar
C. Foschi, M. Salvo, R. Cevenini, and A. Marangoni, “Chlamydia trachomatis antimicrobial susceptibility in colorectal and endocervical cells,” Journal of Antimicrobial Chemotherapy, vol. 73, no. 2, pp. 409–413, 2017.
View at: Publisher Site | Google Scholar
I. M. Petyaev, N. A. Zigangirova, E. Y. Morgunova, N. H. Kyle, E. D. Fedina, and Y. K. Bashmakov, “Resveratrol inhibits propagation of Chlamydia trachomatis in McCoy cells,” BioMed Research International, vol. 2017, Article ID 4064071, 7 pages, 2017.
View at: Publisher Site | Google Scholar
Y. Cong, L. Gao, Y Zhang et al., “Quantifying promoter activity during the developmental cycle of Chlamydia trachomatis,” Scientific Reports, vol. 6, no. 1, p. 27244, 2016.
View at: Publisher Site | Google Scholar
S. Jerchel, I. Kaufhold, L. Schuchardt, K. Shima, and J. Rupp, “Host immune responses after hypoxic reactivation of IFN-γ induced persistent Chlamydia trachomatis infection,” Frontiers in Cellular and Infection Microbiology, vol. 4, p. 43, 2014.
View at: Publisher Site | Google Scholar
R. A. Madan and J. L. Gulley, “Prostate cancer immunotherapy: the path forward,” Current Opinion in Supportive and Palliative Care, vol. 11, no. 3, pp. 225–230, 2017.
View at: Publisher Site | Google Scholar
A. Toledano, M. Bourmech, H. Lamallem et al., “Prospective: how will renal, prostatic and urothelial tumours be treated in 10 years?” Néphrologie & Thérapeutique, vol. 13, no. 1, pp. S115–S125, 2017.
View at: Publisher Site | Google Scholar
M. J. Barry and L. H. Simmons, “Prevention of prostate cancer morbidity and mortality: primary prevention and early detection,” Medical Clinics of North America, vol. 101, no. 4, pp. 787–806, 2017.
View at: Publisher Site | Google Scholar
R. Eeles and H. N. Raghallaigh, “Men with a susceptibility to prostate cancer and the role of genetic based screening,” Translational Andrology and Urology, vol. 7, no. 1, pp. 61–69, 2018.
View at: Publisher Site | Google Scholar
S. D. Brookman-May, R. Campi, J. D. S Henríquez et al., “Latest evidence on the impact of smoking, sports, and sexual activity as modifiable lifestyle risk factors for prostate cancer incidence, recurrence, and progression: a systematic review of the literature by the european association of urology section of oncological urology (ESOU),” European Urology Focus, vol. 8, no. 18, pp. 30069–30075, 2018.
View at: Google Scholar
J. Videčnik Zorman, M. Matičič, S. Jeverica, and T. Smrkolj, “Diagnosis and treatment of bacterial prostatitis,” Acta Dermatovenerol Alp Pannonica Adriat, vol. 24, no. 2, pp. 25–29, 2015.
View at: Google Scholar
F. M. E. Wagenlehner, W. Weidner, and K. G. Naber, “Chlamydial infections in urology,” World Journal of Urology, vol. 24, no. 1, pp. 4–12, 2006.
View at: Publisher Site | Google Scholar
W. Weidner, T. Diemer, P. Huwe, H. Rainer, and M. Ludwig, “The role of Chlamydia trachomatis in prostatitis,” International Journal of Antimicrobial Agents, vol. 19, no. 6, pp. 466–470, 2002.
View at: Publisher Site | Google Scholar
D. Wu, C. U. Thakore, G. G. Wescott, J. A. McCubrey, and D. M. Terrian, “Integrin signaling links protein kinase Cɛ to the protein kinase B/Akt survival pathway in recurrent prostate cancer cells,” Oncogene, vol. 23, no. 53, pp. 8659–8672, 2004.
View at: Publisher Site | Google Scholar
F. Cutruzzolà, G. Giardina, M Marani et al., “Glucose metabolism in the progression of prostate cancer,” Frontiers in Physiology, vol. 8, p. 97, 2017.
View at: Publisher Site | Google Scholar
N. Käding, I. Kaufhold, C Müller et al., “Growth of Chlamydia pneumoniae is enhanced in cells with impaired mitochondrial function,” Frontiers in Cellular and Infection Microbiology, vol. 7, p. 499, 2017.
View at: Publisher Site | Google Scholar
A. A. Abdul-Sater, N. Saïd-Sadier, V. M. Lam et al., “Enhancement of reactive oxygen species production and chlamydial infection by the mitochondrial Nod-like family member NLRX1,” Journal of Biological Chemistry, vol. 285, no. 53, pp. 41637–41645, 2010.
View at: Publisher Site | Google Scholar
E. Eidelman, J. Twum-Ampofo, J. Ansari, and M. M. Siddiqui, “The metabolic phenotype of prostate cancer,” Frontiers in Oncology, vol. 7, p. 131, 2017.
View at: Publisher Site | Google Scholar
M. Esfahani, N. Ataei, and M. Panjehpour, “Biomarkers for evaluation of prostate cancer prognosis,” Asian Pacific Journal of Cancer Prevention, vol. 16, no. 7, pp. 2601–2611, 2015.
View at: Publisher Site | Google Scholar
Z. Culig, “Proinflammatory cytokine interleukin-6 in prostate carcinogenesis,” American Journal of Clinical and Experimental Urology, vol. 2, no. 3, pp. 231–238, 2014.
View at: Google Scholar
P. G. Corn, F. Wang, W. L. McKeehan, and N. Navone, “Targeting fibroblast growth factor pathways in prostate cancer,” Clinical Cancer Research, vol. 19, no. 21, pp. 5856–5866, 2013.
View at: Publisher Site | Google Scholar
H. Sellami, N. Said-Sadier, A. Znazen, R. Gdoura, D. M. Ojcius, and A. Hammami, “Chlamydia trachomatis infection increases the expression of inflammatory tumorigenic cytokines and chemokines as well as components of the Toll-like receptor and NF-κB pathways in human prostate epithelial cells,” Molecular and Cellular Probes, vol. 28, no. 4, pp. 147–154, 2014.
View at: Publisher Site | Google Scholar
S. Caini, S. Gandini, M. Dudas, V. Bremer, E. Severi, and A. Gherasim, “Sexually transmitted infections and prostate cancer risk: a systematic review and meta-analysis,” Cancer Epidemiology, vol. 38, no. 4, pp. 329–338, 2014.
View at: Publisher Site | Google Scholar

Copyright

Copyright © 2019 Ivan M. Petyaev et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

PDF Download Citation

Download other formats

Order printed copies

Views

1884

Downloads

1163

Citations