Table 1: The sequences of PCR/qPCR primers and probes.

Names of the primers Sequences of the primers

RSV F forward primerGGATCCACCATGATGGTCCTCAAAGCAAATGCAATTACCAC
RSV F reverse primerCCACCGCGGCCGCTTATCATTGTCGACCAATATTATTTATACCACTC
GFP forward primerGGATCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGG
GFP reverse primerCCACGCGGCCGCTCATTACTTGTACAGCTCGTCCATGCCGTGAGTGATCC
RSV F QPCR forward primer AACAGATGTAAGCAGCTCCGTTATC
RSV F QPCR reverse primerCGATTTTTATTGGATGCTGTACATTT
RSV F QPCR probe TGCCATAGCATGACACAATGGCTCCT

According to the sequences published by Mentel et al. [27]. All sequences are given 5′-3′ direction.