Table 1: Primer sequences used in the study.

PrimerSequences 5’ to 3’Size (bp)

Uni12AGCRAAAGCAGG

H1N1F- CTTACAGCCATGGGACAGGAACAGG270 bp
R- CTTGTGTAAGCTTGTCCACTCGTGT

H5N1F- ACAGCCATGGAACAGGGACAGGATACA270bp
R- GACCTTGGGTGAGTTTATCCACTCTT

H5N1-F2F- ACCCAATTGATGGACCATTACCTGAG156bp
R- GACCTTGGGTGAGTTTATCCACTCTT

H11N1F- CATACAGCCATGGAACAGGAACAGG270bp
R- CTTGGGTGAGTTTCTTGGGTGAGTTTGTCCACTCTTGT