Synthesis, DNA-Binding, Anticancer Evaluation, and Molecular Docking Studies of Bishomoleptic and Trisheteroleptic Ru-Diimine Complexes Bearing 2-(2-Pyridyl)-quinoxaline

Table 8

Molecular docking studies for 1 and 2 with the sequence (TCATAAATGTATCTAAGTAG)₂ (pdb code: 5D2Q) and (ACCGACGTCGGT)₂ (pdb code: 423D).

Pdb code	Complexes	Ligand moiety	Binding energy (kcal·mol^−1)	Intermolar energy (kcal·mol^−1)	Electrostatic energy (kcal·mol^−1)	Inhibition constant (μM)
5D2Q	(1)	2, 2’-pq	−7.03	−7.03	−0.04	7.05
	(2)	phen	−7.33	−7.33	−0.04	4.22
		2, 2’-pq	−7.18	−7.18	−0.08	5.49
423D	(1)	2, 2’-pq	−6.76	−6.76	−0.08	11.02
	(2)	phen	—	—	—	—
		2, 2’-pq	−6.19	−6.19	−0.07	29.22