Table 1: Primer sequences and PCR conditions.

PrimersOligonucleotide sequence ( to )PCR conditionsReferenceExpected size (bp)

TEM-F TEM-R ATGAGTATTCAACATTTCCG CTGACAGTTACCAATGCTTA 1 cycle of 5  min at 96ºC; 35 cycles of 1 min at 96ºC, 1 min at 58ºC, 1 min at 72ºC; 1 cycle of 10 min at 72ºC[10]867

SHV-F SHV-R GGTTATGCGTTATATTCGCC TTAGCGTTGCCAGTGCTC 1 cycle of 5 min at 96ºC; 35 cycles of 1 min at 96ºC, 1 min at 60ºC, 1 min at 72ºC; 1 cycle of 10 min at 72ºC[10]867

OXA-F OXA-R ACACAATACATATCAACTTCGC AGTGTGTTTAGAATGGTGATC 1 cycle of 5 min at 96ºC; 35 cycles of 1 min at 96ºC, 1 min at 60ºC, 2 min at 72ºC; 1 cycle of 10 min at 72ºC[10]885

CTX-MU1 CTX-MU2 ATGTGCAGYACCAGTAARGT TGGGTRAARTARGTSACCAGA 1 cycle of 7 min at 94ºC; 35 cycles of 50 sec at 94ºC, 40 sec at 50ºC, 1 min at 72ºC; 1 cycle of 5 min at 72ºC[11]593

DHA-1U DHA-1L CACACGGAAGGTTAATTCTGA CGGTTATACGGCTGAACCTG 1 cycle of 5 min at 94ºC; 35 cycles of 30 sec at 94ºC, 45 sec at 50ºC, 1 min at 72ºC; 1 cycle of 8 min at 72ºC[12]970

VEB-1A VEB-1B CGACTTCCATTTCCCGATGC GGACTCTGCAACAAATACGC 1 cycle of 5 min at 96ºC; 30 cycles of 1 min at 96ºC, 1 min at 55ºC, 2 min at 72ºC; 1 cycle of 10 min at 72ºC[13]1014

IntI1-F IntI1-R GGTCAAGGATCTGGATTTGG ACATGCGTGTAAATCATCGTC 1 cycle of 12 min at 94ºC; 35 cycles of 1 min at 94ºC, 1 min at 57ºC, 2 min at 72ºC; 1 cycle of 10 min at 72ºC[14]500

CS CS GGCATCCAAGCAGCAAG AAGCAGACTTGACCTGA 1 cycle of 10 min at 94ºC; 35 cycles of 1 min at 94ºC, 1 min at 54ºC, 2 min at 72ºC; 1 cycle of 8 min at 72ºC[14]

IntI2-F IntI2-R CACGGATATGCGACAAAAAGGT GTAGCAAACGAGTGACGAAATG Same as for int1[14]740

attI2-F orfX-R GACGGCATGCACGATTTGTA GATGCCATCGCAAGTACGAG 1 cycle of 12 min at 94ºC; 35 cycles of 1 min at 94ºC, 1 min at 59.5ºC, 3.5 min at 72ºC; 1 cycle of 10 min at 72ºC[14]2000

IntI3-F IntI3-R AGTGGGTGGCGAATGAGTG TGT TCT TGT ATC GGC AGG TG1 cycle of 12 min at 94ºC; 30 cycles of 30 sec at 94ºC, 30 sec at 60ºC, 1 min at 72ºC; 1 cycle of 8 min at 72ºC[14]600

1, 8F 1R 2F 2R 8R 1,8F 9F 9R GCSATGTGCAGCACCAGTAA ACAAACCGTYGGTGACGATT CTCAATASCGCCATTCCAGG CCGTGGGTTACGATTTTCGC GTCGTACCATAAYCRCCGCT GCSATGTGCAGCACCAGTAA ARTGCAACGGATGATGTYCG GAT GAT TCT CGC CGC TGA AG1 cycle of 5 min at 95ºC; 30 cycles of 30 sec at 95ºC, 30 sec at 63ºC, and 1 min at 72ºC; 10 min at 72ºC.[15]666355529846

GES-A GES-B CTTCATTCACGCACTATTAC TAACTTGACCGACAGAGG 1 cycle of 5 min at 95ºC; 30 cycles of 1 min at 95ºC, 45 sec at 55ºC, 1 min 30 sec at 72ºC; 1 cycle of 8 min at 72ºC[16]827

VIM-F VIM-R AGTGGTGAGTATCCGACAG ATGAAAGTGCGTGGAGAC Same as GES-A[17]225

FOXUP1F FOXUP1R CACCACGAGAATAACC GCCTTGAACTCGACCG Same as GES-A[18]1184

NHAmpCF NHAmpR ATTCGTATGCTGGATCTCGCCACC CATGACCCAGTTCGCCATATCCTG Same as GES-A[18]396

PER-A PER-B GGGACARTCSKATGAATGTCA GGGYSGCTTAGATAGTGCTGAT Same as GES-A
OPAB04GC ACG CGT T1 cycle of 2 min 30 sec at 94ºC; 35 cycles of 30 sec at 94ºC, 1 min at 47ºC, and 1 min at 72ºC; 4 min at 72ºC.[7]
OPB17 AGGGAACGAG Same as OPAB04[8]

REPGCG CCG ICA TGC GGC ATT1 cycle of 7 min at 94ºC; 30 cycles of 30 sec at 94ºC, 1 min at 44ºC, 8 min at 72ºC for 30 cycles; 16 min at 65ºC.[9]

ERIC-1R ATGTAACGTCCTGGGGATTCAC 1 cycle of 2 min and 30 sec at 94ºC; 35 cycles of 30 sec at 94ºC, 1 min at 47ºC, 1 min at 72ºC; 1 cycle of 4 min at 72ºC[19]