BioMed Research International / 2009 / Article / Tab 2

Research Article

Molecular Characterization of the Ghrelin and Ghrelin Receptor Genes and Effects on Fat Deposition in Chicken and Duck

Table 2

Descriptions of the 33 primers used in this study.

GenePrimerForward/reverseSequence ( to )Annealing temp ( )Purpose

cGHRLPM1PM1Ftgctgaaggaccgaaaacaaa56SNP identification
PM1Rgccttgacagatgccttagtg
PM2PM2Faagaaagctggtaactgcactag55SNP identification
PM2Rggtgggctggtggagtta
PM3PM3Ftgcgttctgctactctttttcat63SNP identification
PM3Rgggccaaggaggagtgtct
PM4PM4Fcggcagacactcctcctt57SNP identification
PM4Rgccatccttccaactgtgtatat
PM5PM5Ftatgcgttctgctactcttt58Genotyping by sequencing
PM5Rtggaagcgatcactatacc
PM6PM6Fcatacagcaacaaaaggatac63Real time PCR
PM6Rtgtggttgtccttcagct

cGHSRPM7PM7Fgtgggtcagggcatcaaactc58SNP identification and PCR-RFLP
PM7Rtcgagggctgctgaattttatg
PM8PM8Fggctcttcctttttggtttgtct60SNP identification and PCR-RFLP
PM8Rtcgccctctctctgattcacct
PM9PM9Ftgatgccactggtctgagaat58Genotyping by PCR-RFLP
PM9Rtatccagctgcccatgtaaat
PM10PM10Ftgggcgtcgagcatgagaat63Real time PCR
PM10Rccacgactagcatcttcacag

Chicken -actin PM11PM11Fccccaaagccaacagagaga63Real time PCR
PM11Rggtggtgaagctgtagcctctc

dGHRLPM12PM12FGenomic Walking KitAccording to the kitGenomic Walking
PM12R1ttccatcagttctagacgagt
PM12R2tgtttgtccatactcttgatact
PM12R3gcccctgctttatctgtatc
PM13PM13Fccgcctggtgaagaaaac56RT-PCR
PM13Raagcctacacatccacctgcaat
PM14PM14Fgaggcaagctgaaggacaaccaca54 RACE
PM14R RACE Kit
PM15PM15Fgctggttttcccgtgtaattc56RT-PCR
PM15Rtgtttgtccatactcttgatact
PM16PM16Fgctggttttcccgtgtaattc54Intron 1 amplification
PM16Rtgtttgtccatactcttgatact
PM17PM17Ftggtttggctggctctagt56Intron 2 amplification
PM7RPM12R3
PM18PM18Faaagcaggggcagaagat57Intron 3 amplification
PM18RPM12R2
PM19PM19Fagggtcctggtccaaaaat54Intron 4 amplification
PM19RPM12R1
PM20PM20Fcgcatggtagccttcacacac56SNP identification and PCR-RFLP
PM20Ragccgatgggttagcagagag
PM21PM21Ftcggctccatcagttgcagttat56SNP identification
PM21Rcggcgatgtatttttgctgttg
PM22PM22Ftccccacgacagagtagtttgag56SNP identification and PCR-RFLP
PM22Rgccttcccctgcttcctaa
PM23PM23Fatagcagcattttagaagtga54SNP identification
PM23Rttgcctcagcttttcact
PM24PM24Fcgtgtaattcctctctgctaa63Real time PCR
PM24Rcgatgtatttttgctgttgtt
dGHSRPM25PM25Fcccctgagcaccaacgagt56Intron 1 amplification
PM25Rggcaaccagcagagtatga
PM26PM26FGenomic Walking KitAccording to the kitGenomic Walking
PM26R1cggaccgatgttctttctcttt
PM26R2gacgggcaggaaaaagaagac
PM26R3ggcccagaggatgaggatga
PM27PM27Ftggcgttctccgacctgctcat57SNP identification
PM27Racacagaccctcagaaacac
PM28PM28Fcgggtggcttaaataacaacag56SNP identification
PM28Rtgccctttttcctcagtttctc
PM29PM29Fcggaccataattaaacacctgaa56SNP identification
PM29Rcaggtagaagaggacaaaggaca
PM30PM30Ftggcgttctccgacctgctcat56Genotyping by PCR-RFLP
PM30Racacagaccctcagaaacac
PM31PM31Fgcaggttgtttagatatggct56Genotyping by PCR-RFLP
PM31Rcgtgaaaaggcaaccagcagag
PM32PM32Fcccctgagcaccaacgagt63Real time PCR
PM32Rccaccacaactaacattttcaca

Duck -actin PM33PM33Facgccaacacggtgctg63Real time PCR
PM33Rgggtccggattcatcatactc

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.