Table 2: Primers used in real-time RT-PCR with SYBR green probes.

Primer N315 ORF(a)Sequence

16S rRNAfor(b)SArRNA01CGTGCTACAATGGACAATACAAA
16S rRNArev(b)SArRNA01ATCTACGATTACTAGCGATTCCA
ribAforSA1587GCTTACATTCTGCGTGCCTTAC
ribArevSA1587ACAATCCTATGCCACGACCT
isdAforSA0977GCAACAGCGAAATCTGAAAG
isdArevSA0977AAGGCAACTGTGCTAATAAAG
modAforSA2074TTAACTATGGTGGATCAGGG
modArevSA2074CATGCGCTTTATTCTTGTCT
seoforSA1648AGTCAAGTGTAGACCCTATT
seorevSA1648AGATATTCCATCTAACCAAT
SA1831forSA1831CGTGGTTTATCAACTTGAGT
SA1831revSA1831TATTCTTTAATTCTTGTGCG
srtBforSA0982TAAATAAAGACATTGTTGGATGG
srtBrevSA0982TACGTCGATGTTCTCGCTCA
glpTforSA0325CGACTTTGCTACAAGCGATAA
glpTrevSA0325CGCCCAATCAAGTACACCA
oppFforSA0198TCAGAAGGCTTTATTTGGT
oppFrevSA0198GAATGATTAGTGGTCGTTTA
SA2135forSA2135AACTTAAAGCCTCAACATAG
SA2135revSA2135TAACTTCCAACTGCCATAC
msmXforSA0206CATTTGGGCTAAAGCTACG
msmXrevSA0206GACGCTGTCCACCAGATAA
opp-1FforSA2251TCATCATTACACCCATTTC
opp-1FrevSA2251GCCTTAGATAGACCGACTT
dpsforSA1941TTAGCGGTAGGAGGAAAC
dpsrevSA1941ATCATCGCCAGCATTACC
SA0302forSA0302GAATGGAAAAACAGGAAAAC
SA0302revSA0302GCAAACACATAGCCAATAAG

(a)ORF, open reading frame. (b)refer to references [14].