BioMed Research International / 2009 / Article / Tab 2

Methodology Report

An Improved Method to Knock Out the asd Gene of Salmonella enterica Serovar Pullorum

Table 2

The primer sequences used for PCR amplification.

Gene amplifiedPrimers Primer sequences ( - )Amplicon size (bp)Note

Upstream of asd asdp1ttggatccccgttgaatgatgatgaccg1959BamH I
asdp2ttctcgagtgcgttaggaagggaatcXho I

Downstream of asd asdp3ttctcgaggtagcttaatcccgcgggta2079Xho I
asdp4ttggatccgagcgttcattgtcatcgacBamH I

asdasdp5ttgcttccaactgctgagc 1796(wt)
asdp6tcctatctgcgtcgtcctac1360( + Cm)

actcgaggtgtaggctggagctgcttc1032Xho I
actcgagatgggaattagccatggtccXho I

rfbSrfbSFtgcctatcagagtattagtgt400S.Pullorum

rfbSRtattcacgaattgatatatcc

htohtoFactggcgttatccctttctctgctg495genus Salmonella
htoRatgttgtcctgcccctggtaagaga

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.