BioMed Research International / 2010 / Article / Tab 1

Research Article

Epo Is Relevant Neither for Microvascular Formation Nor for the New Formation and Maintenance of Mice Skeletal Muscle Fibres in Both Normoxia and Hypoxia

Table 1

Sequence and hybridization temperature (Tm) of specific primers.

Gene nameForward 5 to 3 Reverse 5 to 3 TmAmplicon size bpsGenbank accession number

VEGF120GCCAGCACATAGAGAGAATGAGCGGCTTGTCACATTTTTCTGG63°C94NM_001025257
VEGF164GCCAGCACATAGAGAGAATGAGCCAAGGCTCACAGTGATTTTCTGG63°C97M95200
VEGF188GCCAGCACATAGAGAGAATGAGCAACAAGGCTCACAGTGAACGCT63°C171NM_001025250
VEGFR1CGAACTCCACCTCCATGTTTTATCTTCATGGAGGCCTTGG60°C116NM_010228.3
VEGFR2AGAGTTGGTGGAGCATTTGGTAGGCAGGGAGAGTCCAGAA60°C125NM_010612.2
EpoAATGGAGGTGGAAGAACAGGACCCGAAGCAGTGAAGTGA60°C155NM_007942
EpoRGCTCCGGGATGGACTTCAGAGCCTGGTGCAGGCTACAT60°C86NM_010149
𝛽 -actinAGAGGGAAATCGTGCGTGACCAATAGTGATGACCTGGCCGT62°C138NM_007393

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.