BioMed Research International / 2010 / Article / Tab 2

Research Article

Gene Expression Profiling of Placentas Affected by Pre-Eclampsia

Table 2

Primers and PCR conditions.

Gene targetForward primer 5 - 3 Reverse primer 5 - 3 T D a a T D a b T D a c T D a d P C R b
C /c C /c C /c C /c C /c

Fibulin 1A aagttggcaggagtggagac cccccataggtgaatcacag 5 8 / 2 5 7 / 2 5 6 / 2 5 5 / 3 5
sFLT-3 taagcacaccacgcccagtc aagaccgcttgccagctacg 6 9 / 2 6 8 / 2 6 7 / 2 6 6 / 3 0
Inhibin gcttcatgtgggcaaagtcg ccccctttaagcccacttcc 6 4 / 2 6 2 / 6 0 / 5 9 / 2 5 8 / 3 0
Leptin gtccaagctgtgcccatcc cccaggctgtccaaggtctc 6 4 / 2 6 2 / 6 0 / 5 9 / 2 5 8 / 3 0

(a)Touchdown cycle, annealing temperature/number of cycles.
(b)PCR, annealing temperature/number of cycles.